Document Type : Original Article
Authors
1 Department of Genetics, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran;Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran,
2 Mendel Medical Genetics Laboratory, Tehran, Iran
3 4Department of Molecular Biology, Ahar Branch, Islamic Azad University, Ahar, Iran
4 5Department of Laboratory Science, Chalous Branch, Islamic Azad University, Chalous, Iran
5 6Genetic Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran
Abstract
Keywords
Endometriosis is developed as a result of endometrial
tissue exposing outside the uterine cavity. Studies have
reported the pelvic and the peritoneum as the most common
sites of replacement (
This polygenic disease with its complex genetic background
(
Studies on patients diagnosed with endometriosis have
highlighted that
This case-control study enrolled a total of 150 Iranian
women with endometriosis who had referred to Avicenna
Infertility Clinic and Tehran Clinic Hospital, Tehran,
Iran. Diagnostic laparoscopy was performed in all patients.
The severity of endometriosis was determined using
the revised American Society for Reproductive Medicine
(ASRM) classification (stages I-IV of disease).
The control group consisted of 150 women without endometriosis.
Only women who underwent laparoscopy
for non-endometriosis infertility and showed absence of
endometriosis were included as controls. Stages I and II
of endometriosis are commonly found in asymptomatic
women (
Blood was collected in tubes with 200 µl EDTA (0.5
M), as an anti-clotting factor, and stored at -20ºC until
DNA extraction. Genomic DNA was extracted by salting
out method from peripheral blood samples. Genotyping
of the -238G/A (rs361525), -308G/A (rs1800629), -857C/
T (rs1799724) and -863C/A (rs1800630) polymorphisms
in the 5'-untranslated region of
The PCR reactions carried out in final volume of 25 µl containing: 10X PCR Buffer (Roche, Germany), 1.5 mM MgCl2 (Roche, Germany), 0.4 µM of each dNTP (Fermentas, Germany), 5 pmol of each primer, 50 ng template DNA, 1 U Taq DNA polymerase (Roche, Germany) and sterile distilled water up to 25 µl. Amplification conditions start with an initial denaturation step of 5 minutes at 94ºC, followed by 30 cycles of 30 seconds denaturation (94ºC), 30 seconds annealing (63ºC) for -238G/A, -857C/T and -863C/A and 30 seconds annealing (66ºC) for -308G/A and 30 seconds extension (72ºC), ended by a final extension for 5 minutes (72ºC) and finally cooling to 4ºC.
Polymerase chain reaction products were electrophoresed
on a 1.5% agarose gel in 1X TAE and stained
with ethidium bromide and visualized by ultraviolet light.
After reviewing the PCR products, they were treated with
restriction enzymes (Hpa II and NcoI at 37ºC and TaiI at
65ºC) overnight. The digestion products were subjected
to 10% polyacrylamide gel electrophoresis and stained
with silver nitrate (
Results were analyzed by SPSS 24.0 software (IBM SPSS Statistical Software, USA). The analysis of age and body mass index (BMI) in the study groups were performed using t test. The allele frequencies were compared using the Chi-squared test. Genotype distributions in the case and control groups were also analyzed. Age and BMI were considered as potential confounders. The analyses were performed and adjusted in terms of age and BMI using logistic regression. P<0.05 was considered statistically significant. The P value corrected using Bonferroni method for the multiple testing. Logistic regression was used to predict the odds of developing a given disease based on observed characteristics of the patients. In our study, the criterion variable was the logistic regression of disease and no-disease. To perform the statistical analysis using SPSS, we considered the two case and control groups as dependent variables. Age and BMI were considered as covariants and genotype selected as the basis of categorical covariant.
Information about primers and restriction enzymes used
Gene | Variation | Primers (5ˊ-3ˊ) | Size (bp) | Restriction enzyme | Allele | Cutting product (bp) |
---|---|---|---|---|---|---|
-238G/A | F: AGAAGACCCCCCTCGGAACC | 165 | Hpa II (New England BioLabs) | G | 136 | |
R: CTCATCTGGAGGAAGCGGTA | 19 | |||||
-308G/A | F: AGGCAATAGGTTTTGAGGGCCAT | 107 | NcoI (New England BioLabs) | G | 87 | |
R: TCCTCCCTGCTCCGATTCCG | 20 | |||||
-857C/T | F: GGCTCTGAGGAATGGGTTAC | 128 | TaiI (New England BioLabs) | C | 107 | |
R: CCTCTACATGGCCCTGTCTAC | 21 | |||||
-863C/A | F: GGCTCTGAGGAATGGGTTAC | 125 | TaiI (New England BioLabs) | A | 101 | |
R: CTACATGGCCCTGTCTTCGTTACG | 24 | |||||
Representative gel pictures of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) results.
For interaction analysis, the STRING online server
(
According to the analysis of descriptive variables, the
age range was from 19 to 50 years (mean=31, SD=6.1)
in the patients, and from 19 to 44 years (mean=29.2,
SD=5.2) in the control group. The mean BMI (Kg/m2) in
the case and control groups were 25.2 (SD=3.7) and 26.2
(SD=4) respectively. Genotypes of the
The
Genotype and allele frequencies of the four polymorphisms in the promoter region of TNF-α in patients with stage I-IV of endometriosis and controls
Polymorphisms* | Cases | Controls | OR | 95% CI | P value | Corrected P value** | ||
---|---|---|---|---|---|---|---|---|
The -238 (rs361525) | Genotype | GG | 137 (91.3%) | 135 (90.6%) | ||||
GA | 11 (7.3%) | 14 (9.4%) | 0.65 | 0.24-1.71 | 0.381 | 0.762 | ||
AA | 2 (1.3%) | 0 (0.0%) | NA | NA | NA | NA | ||
Allele | G | 285 (95.0%) | 284 (95.3%) | |||||
A | 15 (5.0%) | 14 (4.7%) | 1.07 | 0.51-2.25 | 0.862 | 1 | ||
The -308 (rs1800629) | Genotype | GG | 131 (87.3%) | 127 (84.7%) | ||||
GA | 18 (12.0%) | 21 (14.0%) | 0.8 | 0.35-1.84 | 0.604 | 1 | ||
AA | 1 (0.7%) | 2 (1.3%) | 0 | NA | 0.999 | 1 | ||
Allele | G | 280 (93.3%) | 275 (91.7%) | |||||
A | 20 (6.67%) | 25 (8.3%) | 0.79 | 0.43-1.45 | 0.438 | 1 | ||
The -857 (rs1799724) | Genotype | CC | 102 (68.9%) | 102 (71.3%) | ||||
CT | 43 (29.1%) | 36 (25.2%) | 1.62 | 0.86-3.04 | 0.137 | 0.274 | ||
TT | 3 (2.0%) | 5 (3.5%) | 0.46 | 0.05-4.35 | 0.499 | 0.998 | ||
Allele | C | 247 (83.5%) | 240 (83.9%) | |||||
T | 49 (16.5%) | 46 (16.1%) | 1.03 | 0.66-1.61 | 0.887 | 1 | ||
The -863 (rs1800630) | Genotype | CC | 114 (76.0%) | 99 (66.0%) | ||||
CA | 32 (21.3%) | 44 (29.3%) | 0.66 | 0.35-1.27 | 0.215 | 0.43 | ||
AA | 4 (2.7%) | 7 (4.7%) | 0.68 | 0.19-2.47 | 0.557 | 1 | ||
Allele | C | 260 (86.7%) | 242 (80.67%) | |||||
A | 40 (13.3%) | 58 (19.3%) | 0.64 | 0.41-0.99 | 0.047 | 0.188 | ||
OR; Odds ratios, CI; Confidence interval, BMI; Body mass index, NA; No answer, *; The effect of genotypes were adjusted by age and BMI, and **; The P value corrected using Bonferroni method for the multiple testing.
TNF-α promoter polymorphisms studies
SNP name | Association with susceptibility | |
---|---|---|
Association Population/(number of cases and controls) | No-association Population/(number of cases and controls) | |
-1031T/C | Japanese (123, 165) (Teramoto et al.) (20)Japanese (130, 185) (Asghar et al.) (12)Iranian (135, 173) (Saliminejad et al.) (15)Iranian (65, 65) (Abutorabi et al.) (16) | Australian (958, 959) (Zhao et al.) (19) |
-863C/A | Japanese (123, 165) (Teramoto et al.) (20)Iranian (150, 150) (This study)*, £ | Japanese (130, 185) (Asghar et al.) (12) |
-857C/T | Japanese (123, 165) (Teramoto et al.) (20)Iranian (148, 143) (This study)£ | Japanese (130, 185) (Asghar et al.) (12)Australian (958, 959) (Zhao et al.) (19)Iranian (148, 143) (This study)** |
-308G/A | Iranian (150, 150) (This study)£ | Taiwanese (120, 106) (Hsieh et al.) (13)Korean (70, 202) (Lee et al.) (17)Austrian (92, 69) (Wieser et al.) (18)Japanese (130, 185) (Asghar et al.) (12)Australian (958,959) (Zhao et al.) (19)Chinese (76,87) (Lu et al.) (14)Iranian (65, 65) (Abutorabi et al.) (16)Iranian (150, 150) (This study)** |
-238G/A | Iranian (150, 150) (This study)£ | Korean (70, 202) (Lee et al.) (17)Austrian (92, 69) (Wieser et al.) (18)Japanese (130, 185) (Asghar et al.) (12)Australian (958, 959) (Zhao et al.) (19)Iranian (65, 65) (Abutorabi et al.) (16)Iranian (149, 150) (This study)** |
BMI; Body mass index, *; Allele frequencies, **; Genotype adjusted by age and BMI, and £; case and control and BMI adjusted by age.
Endometriosis is a multifactorial disease with both genetic
and environmental components (
The effects of polymorphisms on cytokines genes have
been examined by many studies (
All in all, endometriosis has been reported to be linked
with a number of polymorphisms of
According to the studies mentioned,
It has been shown that the presence of polymorphism
in promoter regions can affect gene expression (
This study has some limitations in spite of its strengths. The limitations of our study on endometriosis were not only the difficulty in choosing the controls, but also in recruiting patients. This is because laparoscopy should be undertaken to confirm the disease and its steady state that was a matter of time to collect samples.
We investigated the association of four polymorphisms
in the promoter region of