Document Type : Original Article
Authors
1 Department of Molecular and Cellular Sciences, Faculty of Advanced Sciences and Technology, Science and Research Branch, Islamic Azad University, Tehran, Iran;Department of Genetics, Reproductive Biomedicine Research Ce
2 Department of Andrology, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran
3 Department of Genetics, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran
4 4Department of Epidemiology and Reproductive Health, Reproductive Epidemiology Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran
Abstract
Keywords
Infertility, defined as the failure to conceive after one
year of regular intercourse, is caused by male factors in
15% of cases (
AZFc is the most common Yq microdeletion (
The chance of sperm retrieval during surgical or microsurgical procedures such as testicular sperm extraction (TESE), known as microTESE, may be predicted if there is a microdeltion in the AZF region (
This cross-sectional study was conducted during 2013-2014. A total of 200 infertile men with azoospermia/severe oligospermia, as candidates for microTESE surgery at the Royan Infertility Center, were included. The study was approved by the Ethics Committee of the Royan Institute (IR.ACECR.ROYAN.REC.1395.1) and written consent was obtained from the patients. The patients were checked for AZF full microdeletions and reported as normal based on the EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions (
PAXgene Blood DNA kit (Qiagene, Germany) and the salting out method were used for DNA extraction. Quality and concentration of extracted DNA from peripheral blood was checked by Nanodrop Spectrophotometer 2000 (Thermo Scientific, USA). AZFc partial deletions were analyzed using multiplex polymerase chain reaction (PCR) of seven sequence-tagged site (STS) markers as previously described (
Statistical analyses were performed using SPSS 18.0 statistical software (SPSS, Inc., Chicago, IL, USA). Continuous variables were analyzed using the independent sample t test and categorical variables were analyzed using chi-square test. P<0.05 was considered statistically significant.
The sequence-tagged site (STS) markers included in each multiplex polymerase chain reaction (PCR) mix. Each marker and its relationship to azoospermia factor c (AZFc) subregions, its related primer set and product size are shown
Marker | b2/b4 | b2/b3 | gr/gr | b1/b3 | Primer sequence (5ˊ-3ˊ) | Product size (bp) | |
---|---|---|---|---|---|---|---|
Mix A | SY1197 | + | + | + | _ | F: TCATTTGTGTCCTTCTCTTGGA | 435 |
R: CTAAGCCAGGAACTTGCCAC | |||||||
SY1161 | + | + | + | _ | F: CGACACTTTTGGGAAGTTTCA | 330 | |
R: TTGTGTCCAGTGGTGGCTTA | |||||||
SY1201 | + | + | + | + | F: CCGACTTCCACAATGGCT | 677 | |
R: GGGAGAAAAGTTCTGCAACG | |||||||
SY1206 | _ | + | + | + | F: ATTGATCTCCTTGGTTCCCC | 394 | |
R: GACATGTGTGGCCAATTTGA | |||||||
Mix B | SY1191 | _ | _ | + | _ | F: CCAGACGTTCTACCCTTTCG | 385 |
R: GAGCCGAGATCCAGTTACCA | |||||||
SY1291 | _ | + | _ | _ | F: TAAAAGGCAGAACTGCCAGG | 527 | |
R: GGGAGAAAAGTTCTGCAACG | |||||||
SY1258 | + | + | + | + | F: AACCCCATCTCTAGCAAAAATATG | 930 | |
R: TAGGTGACAGGGCAGGATTC | |||||||
The clinical characteristics of infertile men
Patients groups | Age(Y) | FSH(mIU/mL) | LH(mIU/mL) | Testosterone(mg/mL) |
---|---|---|---|---|
TESE positive n=90 | 39.19 ± 6.6 | 22.87 ± 17.05 | 11.4 ± 8.20 | 3.86 ± 4.95 |
TESE negative n=110 | 39.22 ± 6.22 | 24.71 ± 15.61 | 15.12 ± 10.66 | 3.59 ± 1.97 |
Values are mean ± SEM (P=0.974, P=0.431, P=0.006, P=0.627, respectively). FSH; Follicle-stimulating hormone, LH; Luteinizing hormone, TESE; Testicular sperm extraction. Normal ranges: FSH: 2-10 mIU/mL, LH: 1.0-9.5 mIU/mL, Testosterone: >2.4 mg/mL.
Demographic characteristics of the patients including age and hormonal profile are summarized in Table 2. Of the 200 infertile men, 90 cases had a successful microTESE. In assessing partial AZFc deletions, we identified 11 cases of gr/gr and 5 cases of b2/b3 microdeletions among all cases, however, no b1/b3 partial AZFc microdeletion was identified. In samples with a gr/gr deletion, a 527 bp PCR product representing the sY1291 STS marker was missing while those carrying b2/b3 deletions lacked a 385 bp product for the sY1191 STS marker (
Results for multiplex polymerase chain reaction (PCR). A. Mix A, the band sizes match the relevant sequence-tagged site (STS) markers. No deletion was detected in three samples and B. Mix B, sample 6 is showing a missing band for sY1291 which is representative for a gr/gr deletion while sample 10 has a missing band for sY1191 which is indicative of a b2/b3 deletion in the azoospermia factor c (AZFc) region.
Partial azoospermia factor c (AZFc) microdeletions in infertile men with micro testicular sperm extraction (TESE) surgery. A. Percentage of gr/gr deletions. Comparison showed no significant difference (P=0.201) in those with successful micro TESE compared to those with failed surgery and B. Percentage of b2/b3 microdeletion. Also no significant difference was detected between those with and without sperm retrieval during micro TESE surgery (P=0.82).
AZFc partial deletions in infertile men based on microTESE outcome. The number and percentage of AZFc partial deletions in each category are shown
AZFc partial deletion | ||||
---|---|---|---|---|
Micro TESE result | n | gr/gr | b2/b3 | Total |
Successful | 90 | 7 (8%) | 2 (2.2%) | 9 (10%) |
Failed | 110 | 4 (3.6%) | 3 (2.7%) | 7 (6.4%) |
P value | - | 0.201 | 0.820 | 0.346 |
Total | 200 | 11 (5.5%) | 5 (2.5%) | 16 (8%) |
AZF; Azoospermia factor and TESE; Testicular sperm extraction.
Infertile men with azoospermia/severe oligospermia are usually selected for sperm retrieval surgeries such as microTESE for further assisted reproductive technology (ART) procedures. It is usually recommended to determine AZF microdeletions before surgery to predict the chance of microTESE success (
Previous reports on the importance of AZFc partial deletions such as gr/gr and b2/b3 are controversial and seemingly due to ethnic heterogeneity and differences in genetic backgrounds (
Giachini et al. (
We found no evidence for partial AZFc microdeletion influencing outcome of sperm extraction during microTESE. A larger association study may reveal the diagnostic value of such deletions in men who are candidates for microTESE.