Document Type : Original Article
Authors
1 Department of Immunology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2 Department of Immunology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran;Fertility, Infertility, and Perinatology Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3 Department of Immunology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran;Cellular and Molecular Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
Abstract
Keywords
Leukemia inhibitory factor (LIF) is a glycoprotein cytokine with a molecular weight of 38-67 kDa. That is a
member of the interleukin 6 family. LIF receptor is a heterodimer composed of two chains, gp130 and leukemia
inhibitory factor receptor-β (LIFR-β) expressing on the
surface of trophoblast cells (
This experimental study approved by Ethics Committee of Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran (Ethics code: IR.AJUMS.REC.1395.577).
JEG-3 choriocarcinoma cells were purchased from the
Pasteur Institute of Iran (Tehran, Iran). These cells were
maintained in Dulbecco’s modified Eagle’s medium-F12
(DMEM-F12; GIBCO, Ireland) supplemented with 10%
heat-inactivated fetal bovine serum (FBS; GIBCO, Ireland) along with penicillin (BioIdea, Iran;100 units/ml)
and streptomycin (BioIdea; 100μg/ml). All JEG-3 cultures were commenced at 106 cells/175-cm2 flask and
maintained under standardized conditions (37˚C, 5% CO2,
humidified atmosphere). The cells were trypsinized twice
a week when confluence was estimated at over 75%. For
all assays, JEG-3 cells were adjusted to 105 cells/ml. The
cells (105cell/ml) were seeded in six-well plates, following the resuspension in complete growth media. Before
adding the stimuli, the cells were starved for 2 hours in
medium without FBS. The cells were cultured per well
in the presence and absence of different concentrations (1
ng/ml, 10 ng/ml, 50 ng/ml) (
RNA was isolated using TRI Reagent (SinaClonCo.,
Iran). According to the manufacturer’s protocol, and the
purity of extracted RNA was determined by the A260/
A280 ratio (A260/A280 ratio was 1.8). 50-100 ng RNA
was reverse transcribed using cDNA synthesis kit (SinaClonCo.)
and relative changes in
All of the experiments were repeated in triplicates and data were demonstrated as means ± standard error (SE). Statistical software SPSS 25.0 and Graphpad Prism 8.0.1 were used for data analysis. Delta CTs were subjected to one-way ANOVA and a post hoc Tukey’s test, while the non-parametric Kruskal-Wallis test was used to compare the results of different experimental days. P values lower than 0.05 were considered statistically significant.
Effects of different concentrations of LIF on VEGF
gene expression level This study evaluated the effects
of different concentrations of LIF on
Gene specific primers used for RT-PCR
Primer (accession) | Sequence (5'-3') | Tm | Amplicon size |
---|---|---|---|
F: AGGAGGAGGGCAGAATCATCA | 60 | 76 bp | |
R: CTCGATTGGATGGCAGTAGCT | |||
F: TGGGCTACACTGAGCACCAG | 60 | 72 bp | |
R: CAGCGTCAAAGGTGGAGGAG | |||
VEGF gene expression level at different time points, under treatment with different concentrations of LIF. The effect of different concentrations of
LIF (1, 10 and 50 ng) on VEGF gene expression after
Comparing total VEGF gene expression at different time (
An analysis of 6 hours data showed that by increasing
LIF concentration, level of VEGF gene expression was
decreased. In this time point, there is a significant difference (P<0.001) between the rate of VEGF gene expression in comparison with each other at different concentrations and control (
After 12 hours, there was a significant reduction in the
Twenty-four hours after cells treatment with different
concentrations of LIF, the results showed lowest expression of the
After 48 hours, like 12 and 24 hours,
After 72 hours, effect of LIF on the
As shown in Figure 3,
Changes in
Pregnancy is a complex process that depends on many
factors. Studies have shown that cytokines, growth factors and several transcription factors play important roles
in embryo implantation. For example, production of LIF
by endometrial cells is essential for the beginning of implantation (
Considering the mentioned roles for VEGF during pregnancy and relevant disorders, as well as the important role
of LIF during pregnancy, we decided to investigate the
effect of LIF on the level of
In conclusion, recent studies have shown that both LIF
and VEGF are essential for maintaining and initiating the
pregnancy process. It has also been found that angiogenesis process is a critical procedure in embryonic trophoblast cells for a normal pregnancy. VEGF-A is one of
the most important angiogenic factors. Therefore, in this
study we investigated the effect of LIF on