Document Type : Original Article
Authors
1 Department of Anatomical Sciences, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran
2 Department of Anatomical Sciences, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran;Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran
3 Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4 Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran;4Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences
Abstract
Keywords
Embryo cryopreservation, an important component of assisted reproductive technologies (ARTs), has considerably
improved the clinical results of this technology (
Long non-coding RNAs (lncRNAs) are transcripts with
more than 200 up to several thousand nucleotides. Although
most of these molecules do not have protein coding capacity,
some of them code small peptides of less than 100 aminoacids (
lncRNAs have important regulatory roles in many cellular processes such as gene expression, imprinting, cytoplasmic scaffolds and intracellular trafficking. They affect
cell function during development and differentiation (
A review of the literature showed no data that pertained
to an association between embryo vitrification and lncRNA
expressions. Thus, considering the importance of
This experimental study, approved by and Ethical Committee of Shahid Beheshti University of Medical Sciences (Tehran, Iran, Ethical permission number: IR.SBMU. RETECH.REC.1396.997). All animal experiments were conducted in compliance with the guidelines established by this university for the keeping and manipulate of laboratory animals.
All chemicals and reagents were obtained from Sigma Chemical Company (St. Louis, USA) unless otherwise noted.
We obtained 6-8 weeks old female and 10-weeks old male NMRI mice from Royan Institute (Tehran, Iran) to use in this study. The mice were accommodated under the controlled conditions of 12 hours light: 12 hours dark photoperiod at room temperature (22 ± 2°C) and 50 ± 10% humidity with ad libitum use of food and water. The animals were killed by cervical dislocation.
Female mice were superovulated by intraperitoneal (IP) injection of 10 IU pregnant mare serum gonadotropin (PMSG; Pregnecol®, Australia), followed 48 hours later by 10 IU human chorionic gonadotropin (hCG; Pregnyl). The experiment was carried out on three treatment groups: control, IVF, and vitrification as shown in Figure 1.
In the control group, after hCG injection, female mice
were mated with male mice. Successful mating was
verified by the detection of a vaginal plug, the next day
morning. Fresh blastocysts were collected from the mice
uteri by flushing the uterine horns with FHM flushing
media 94 hours posthCG, according to the previous
study (
Experimental design and IVF;
In the IVF and vitrification groups, we collected the cumulus oocyte complexes containing metaphase II (MII) oocytes from the oviduct ampullae 14-16 hours after hCG injection. The oocytes were released into FHM medium and then transferred to 50 μl droplets of human tubal fluid medium (HTF) supplemented with 4 mg/ml bovine serum albumin (BSA).
IVF was performed as formerly explained (
In the vitrification group, the 2-cell embryos were vitrified by the cryotop method with Kitazato Vitrification Kit
(Kitazato Biopharmaceuticals, Japan), as previously described (
RNA extraction, complementary DNA (cDNA) synthesis, and quantitative reverse-transcription PCR (qRTPCR) analysis were carried out according to the previous
study protocols (
qRT-PCR was executed to evaluate the amount of
Statistical analyses were performed by applying the
Statistical Package for the Social Science software, version 16 (SPSS, USA). Cleavage and developmental ratio
to blastocysts stage between IVF and vitrification groups
were compared by the non-parametric Mann- Whitney
test. The relative gene expression levels of
We assessed the effect of vitrification on developmental
competence of preimplantation embryos. The 2-cell embryos obtained from IVF in three runs were divided into
two groups. Totally, for the IVF group, there were 170 cultured 2-cell embryos. In the vitrification group, 166 embryos (2-cell) were vitrified/ thawed. The vitrification group
had a survival rate of 96.72% ± 2.93, after vitrification and
warming. We compared the percentage rates of the 4-cell,
8-cell and morula stages between the IVF and vitrification groups. There was no significant difference between
these two groups, in terms of cleavage rate. The blastocyst
(64.04% ± 10.16) and hatching (48.51% ± 10.92) rates in
the vitrification group were significantly lower than the
blastocyst (82.63% ± 2.56; P<0.037) and hatching (69.22%
± 5.20; P<0.041) rates in the IVF group (
Details of primers applied for RT-PCR and qRT-PCR
Genes | Nucleotide sequences (5′–3′) | Tempreture (°C) | GC% | Self-complementarity | Accession number |
---|---|---|---|---|---|
F: CTGAAGAAAAGAAGACTGAGGAC | 56.8355.86 | 43.4850.00 | 3.003.00 | NR_003633.3 | |
R: CGATTTACAGTTGGAGGGTC | |||||
F: CTGCGAAATAGACGTTCGG | 56.5657.14 | 52.6357.89 | 4.004.00 | XM_006515457.3 | |
R: GTACTGGCCTTTCTCCAGG | |||||
F: AGACTGATACATACGCCTGC | 57.2056.80 | 50.0050.00 | 3.006.00 | M_009735.3 | |
R: ATCACATGTCTCGATCCCAG | |||||
RT-PCR; Reverse transcriptio polymerase chain reaction, and qRT-PCR; Quantitative reverse transcription polymerase chain reaction. GC; Guanine - Cytosine Percent.
Development of 2-cell mouse embryos in vitro fertilization and vitrification groups
Group | 2-cell embryos(n) | Survival rate | 4-cell rate | 8-cell rate | Morula rate | Blastocysts rate | Hatched rate |
---|---|---|---|---|---|---|---|
IVF | 177 | 100%(170/170) | 95.36% ± 1.17(162/170) | 92.19% ± 2.83(157/170) | 88.04% ± 2.59(150/170) | 82.63% ± 2.56*(141/170) | 69.22% ± 5.20**(117/170) |
Vitrification | 166 | 96.72% ± 2.93(160/166) | 92.32% ± 2.64(148/160) | 84.49% ± 6.92(135/160) | 76.6% ± 7.58(123/160) | 64.04% ± 10.16*(102/160) | 48.51% ± 10.92**(77/160) |
Data are presented as mean ± SD or n (%). *Significant difference (P<0.037), **Significant differences (P<0.041)
qRT-PCR was implemented to appraise the expression
levels of the lncRNA
Relative expression levels of mouse of gene trap locus 2 (
Vitrification is an encouraging technology to cryopreserve gametes and embryos in ART clinics. The main
challenge faced by researchers is to evaluate the consequences of this process on healthy and affectedadults
conceived by IVF and optimization of this important
technology (
We assessed the embryonic developmental potential
after vitrification by comparing cleavage, blastocysts
and hatching rates of the non-vitrified embryos (IVF
group) compared to the vitrified embryos (vitrification
group). The results showed that vitrification/warming
at the 2-cell stage significantly decreased blastocysts
and hatching rates in mouse preimplantation embryos.
This finding provided evidence of the adverse effects
of vitrification on development of preimplantation
embryos. This result supported earlier observations
where vitrification negatively impacted development
of preimplantation mouse embryos (
Recent evidence suggests that ART, including superovulation, IVF and vitrification cause a disturbance in
genetic and epigenetic mechanisms in the pre-implanted embryo affecting health of the children conceived
by ART (
In conclusion, vitrification at the 2-cell stage adversely affected preimplantation mouse embryo development. In addition, IVF and vitrification interrupted the expressions of lncRNA Gtl2 and its reciprocal imprinted gene, Dlk1, in mouse blastocysts. This study was the first to assess expression of lncRNAs following ART manipulation. Due to the importance of lncRNAs in embryo development, more research would be needed to evaluate lncRNA expressions in embryos conceived by ART.