Document Type : Short Communication
Authors
1 Research and Clinical Center for Infertility, Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, Iran;Medical Biotechnology Research Center, Ashkezar Branch, Islamic Azad University, Yazd,
2 Reproductive Immunology Research Center, Shahid Sadoughi University of Medical Sciences, Yazd, Iran
3 4Department of Biology, Science and Arts University, Yazd, Iran
4 Medical Biotechnology Research Center, Ashkezar Branch, Islamic Azad University, Yazd, Iran
5 Research and Clinical Center for Infertility, Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, Iran
Abstract
Keywords
Genetic factors are responsible for 50% or more of male
infertility etiology and nearly 7% of men suffer from infertility
worldwide (
Two types of protamines are known to exist in humans,
amely protamine1 (PRM1) and protamine 2 (PRM2). The
expression of this two proteins in the sperm nucleus is
almost equal (
Therefore, due to the importance of protamines in male
fertility, many studies have shown altered expression of protamines
in several groups of infertile men (
In this case-control study, semen samples were collected
from 35 fertile men (control group) and 30 infertile men
(case group) referred to our Andrology Lab at the Research
and Clinical Center for Infertility of Yazd. Sperm samples
were obtained after informed consent from the participants.
A comprehensive evaluation was undertaken to identify the
etiology of infertility including physical examination, smoking
history, and reproductive hormonal assays. The infertile
man was defined as a man who had no child after a period of
unprotected intercourse for more than one year. The control
group included fertile donors with one naturally conceived
child during the past 12 months who also had normal semen
parameters according to the recommendations of the
World Health Organization (WHO, 2010). Heavy smokers
(more than one pack of cigarettes per day during the past
year), drug addicts, alcohol consumers, men with a history of
varicocele and those aged more than 45 years were excluded
from the study. Theliquefiedsemen of each man was evaluated
for sperm parameters according to to WHO 2010 (
Genomic DNA isolation from peripheral blood samples
was performed using the protease and phenol purification
protocol (
Two primer pairs for amplification of the
Gene | Sequence primer (5'-3') | Product size (bp) |
---|---|---|
F: cccctggcatctataacaggccgc | 558 | |
R: tcaagaacaaggagagaagagtgg | ||
F: ctccagggcccactgcagcctcag | 599 | |
R: gaattgctatggcctcacttggtg | ||
After PCR, all of the PCR products were purified and
sequenced on an Applied Biosystems 3730 XL DNA
analyzer according to the manufacturer’s instructions.
Using designed primers (forward and reverse),
the amplified products with sizes of 557 nucleotides
(from-42 to 515) for
In this study, we used SPSS 20 (SPSS Inc., Chicago,
IL, USA) for all statistical analyses. The frequency of
SNPs in
A total of 65 semen samples were examined in two
groups. The mean age of participants was 35.21 ± 5.5
vs. 33.71 ± 4.5 years in the case and control groups
respectively. In the case and control group, we observed
three SNPs in
The frequency of these SNPs differed in groups
of fertile and infertile men. The three SNPs G102T
and C49T in
Table 3 shows the association of the most frequent
genotypes (three SNPs) with seminal characteristics
of participants (
Abnormal morphology, as well as sperm apoptosis
(TUNEL+), was significantly elevated in the
GG genotype compared with other genotypes in
rs1646022 and rs2070923 in
In this study, infertile men with a history of defects
at sperm head morphology and stretch of this
region (tapered head) were analyzed for
Polymerase chain reaction (PCR) product of genomic DNA using specific primers. A.
The frequency of single nucleotide polymorphisms (SNPs) in PRM1 and PRM2 in case and control groups
Gene | Nucleotide change | Region | AA change | NCBI ID | Infertile | Fertile | P value | ||
---|---|---|---|---|---|---|---|---|---|
Genotypefrequency (%) | Allele frequency | Genotypefrequency (%) | Allele frquency | ||||||
P1 | C230A | Exon | None | rs737008 | CC: 0.0 | C(48) | CC: 26 | C(54.5) | 0.000 |
CA: 96 | A(52) | CA: 57 | A(45.5) | 0.002 | |||||
AA: 4 | AA: 17 | ||||||||
G102T | Exon | R→S | - | GG: 100 | G(100) | GG: 100 | G(100) | NS | |
GT: 0.0 | T(0) | GT: 0.0 | T(0) | NS | |||||
TT: 0.0 | TT: 0.0 | ||||||||
C49T | Exon | R→C | - | CC: 100 | C(100) | CC: 100 | C(100) | NS | |
CT: 0.0 | T(0) | CT: 0.0 | T(0) | NS | |||||
TT: 0.0 | TT: 0.0 | ||||||||
P2 | C288T | Intron | None Coding | rs115686767 | CC: 100 | C(100) | CC: 94.11 | C(97.05) | NS |
CT: 0.0 | T(0) | CT: 5.89 | T(2.95) | NS | |||||
TT: 0.0 | TT: 0.0 | ||||||||
C401T | Intron | None Coding | rs545828790 | CC: 100 | C(100) | CC: 100 | C(100) | NS | |
CT: 0.0 | T(0) | CT: 0.0 | T(0) | NS | |||||
TT: 0.0 | TT: 0.0 | ||||||||
C248T | Exon | E-Q | - | CC: 100 | C(100) | CC: 100 | C(100) | NS | |
CT: 0.0 | T(0) | CT: 0.0 | T(0) | NS | |||||
TT: 0.0 | TT: 0.0 | ||||||||
G398C | Intron | None Coding | rs1646022 | GG: 44.44 | G(63.87) | GG: 31.25 | G(62.5) | 0.004 | |
GC: 38.86 | C(36.13) | GC: 62.5 | C(37.5) | 0.012 | |||||
CC: 16.7 | CC: 6.25 | ||||||||
A473C | Intron | None Coding | rs2070923 | AA: 33.33 | A(50) | AA: 43.75 | A(63.55) | 0.073 | |
AC: 33.34 | C(50) | AC: 39.59 | C(36.45) | 0.007 | |||||
CC: 33.33 | CC: 16.66 | ||||||||
G 271C | Intron | None Coding | rs201933708 | GG: 100 | G(100) | GG: 93.75 | G(96.87) | NS | |
GC: 0.0 | C(0) | GC: 6.25 | C(3.13) | NS | |||||
CC: 0.0 | CC: 0.0 | ||||||||
Logistic Regression Modeling was used for statistical analysis. All P values were two-sided and considered significant at the 0.05 level and showed the comparisons between the allele frequencies in case and control groups. P1; PRM1, P2; PRM2, AA; Amino acid R; Arginine, S; Serine, C; Cysteine, Q; Termination codon, E; Glutamic acid , and NS; No significant.
Association of C230A polymorphism in PRM1 with sperm characteristics
Genotype | Apoptosis | Protamine deficiency | Abnormal motility | Concentration | Abnormal morphology |
---|---|---|---|---|---|
CC (n=6) | 45.66 ± 16.23 | 35.6 ± 12.34 | 41.85 ± 6.89 | 64.83 ± 58.67 | 5.26 ± 3.49 |
CA (n=55) | 30.8 ± 12.45 | 27.33 ± 9.67 | 45.33 ± 7.34 | 77.47 ± 60.5 | 48.48 ± 29.78 |
AA (n=4) | 56 ± 18.96 | 29.66 ± 10.56 | 23.5 ± 3.45 | 49.25 ± 32.75 | 1.4 ± 0.32 |
P value | <0.001* | 0.157 | <0.001* | 0.602 | <0.001* |
Values are presented as a mean ± standard deviation. Tukey’s test was used for statistical analysis. *; The P<0.05 were considered to indicate statistical significance. Evaluating the sperm parameters was according to the World Health Organization (WHO, 2010).
Association of PRM2 G398C and A473C polymorphisms with human sperm characteristics
Genotype | Apoptosis | Protamine deficiency | Abnormal motility | Concentration | Abnormal morphology |
---|---|---|---|---|---|
rs1646022 | |||||
GG (n=6) | 43.4 ± 18.3 | 28.75 ± 9.25 | 47 ± 8.45 | 74.4 ± 34.5 | 2.33 ± 2.13 |
GC (n=55) | 29.9 ± 9.94 | 30.9 ± 15.45 | 57.54 ± 12.36 | 52.54 ± 28.75 | 28.7 ± 18.5 |
CC (n=4) | 12.25 ± 3.88 | 37.75 ± 17.72 | 60 ± 14.87 | 74.5 ± 38.65 | 27.75 |
P value | <0.001* | 0.63 | 0.12 | 0.11 | 0.003* |
rs2070923 | |||||
AA (n=16) | 24.83 ± 8.25 | 27.33 ± 6.85 | 55.66 ± 10.76 | 84.83 ± 64.23 | 33.33 ± 23.32 |
AC (n=34) | 13.5 ± 3.97 | 26 ± 11.83 | 63.33 ± 8.69 | 102.66 ± 85.43 | 37 ± 30.54 |
CC (n=15) | 41 ± 14.28 | 26.66 ± 12.35 | 44.66 ± 10.73 | 54.66 ± 47.23 | 5 ± 4.55 |
P value | <0.001* | 0.92 | 0.02* | 0.12 | <0.001* |
*; The P<0.05 were considered to indicate statistical significance. Data are presented as mean ± SD. Post-hoc test to ANOVA was used for statistics evaluating the sperm parameters was according to the World Health Organization (WHO, 2010).
Protection and support of the sperm genome are the
main functions of protamines. It is shown that incomplete
protamination of sperm DNA causes high susceptibility
of the genome to nucleases, endogenous and exogenous
free radicals and mutagens (
Although Aoki et al. (
We saw that the concentration of sperm cells was lower
in the case group than controls. Also, total motility and
sperm morphology were significantly lower in the case
group than in the control group. Furthermore, we showed
significantly higher rates of protamine deficiency as well
as sperm apoptosis in patients with tapered sperm compared
with the fertile group using CMA3 florescent staining and TUNEL assay respectively (
We show that