Document Type : Original Article
Authors
1 Thalassemia and Hemophilia Genetic, PND Research Center, Dastgheib Hospital, Shiraz University of Medical Science, Shiraz, Iran
2 Infertility Research Center, Shiraz University of Medical Sciences, Shiraz, Iran;Depatment of Urology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
3 Infertility Research Center, Shiraz University of Medical Sciences, Shiraz, Iran;4Department of Obstetrics and Gynecology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
4 4Department of Obstetrics and Gynecology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran;5IVF Center, Ghadir Mother and Child Hospital, Shiraz University of Medical Sciences, Shiraz, Iran
Abstract
Keywords
Approximately 15% of all couples of reproductive
age have difficulty conceiving a child (
Proper spermatogenesis is dependent on numerousgenes, many of which are located on the long arm of theYchromosome (Yq11). A10 Mb region on the long armof the Ychromosome, namely the azoospermia factor(AZF) region, is frequently deleted in men with unex.
plained spermatogenic failure. AZF was first mapped in1976 to Yq11 and has shown to play an important rolein male germ cell proliferation and differentiation
(
Yq has many palindrome repeats across the AZF.
The homologous recombination between these repeats
generates microdeletions in the AZF sub-regions,
which in turn may lead to spermatogenic failure (
The worldwide incidence of YCD is approximately
1-55.5% in infertile men showing significant variation
among different populations (
In this case-control study, a total of 140 infertile men, from couples who had undergone ART at the Infertility Center of Ghadir Mother and Child Hospital, and 100 fertile men without any history of primary or secondary infertility and with at least one phenotypically normal child, who were referred to the Genetics Research Center at Shahid Dastghaib Hospital, were enrolled in this case-control study.
The infertile men with known karyotype abnormalities, obstructive azoospermia, varicocele, testicular tumors and abnormal physical examinations were excluded, resulting in a case group consisting of 97 men. These individuals had either non-obstractive azoospermia (NOA) or oligozoospermia (defined as sperm counts less than 15×106 according to the World Health Organization 2010. This study was approved by the Institutional Ethics Committee of Shiraz University of Medical Sciences and all of the participants signed a written consent form before enrolment. All 197 participants consciuosly donated a 2 ml peripheral blood sample and DNA was extracted from these samples by a commercial DNA extraction kit (Qiagen, Germany) and YCD typing was undertaken.
The hospital charts of the 97 infertile men were
checked for their semen analysis parameters, hormonal
profiles and ART outcomes. Semen samples had
been analyzed for standard sperm quality parameters
(volume, count, rates of motility and morphology)
according to the World Health Organization (2010)
and the Kruger classification (
Samples were tested for classical YCD by typing six STSs, namely sY84, sY86, sY127, sY134, sY254 and sY255 by using the YChromStrip kit (Operon, Spain) for cases and a manual PCR method for all controls. Initially, the ZFX/ZFY was used to determine the presence of Y chromosome in all tested individuals. The detection of sY14 (SRY) was employed as an internal control of PCR.
To detect AZFa, AZFb and AZFc, sY86, sY127 and sY254 were used for Multiplex PCR I and sY84, sY134 and sY255 were used for Multiplex PCR II. Multiplex PCR reactions were carried out in a total volume of 50 µL. Amplifications were carried out on a thermocycler (Eppendorf, Germany) with cycling conditions of an initial denaturation at 94°C for 15 minutes followed by 35 cycles of 94°C for 30 seconds for denaturation, 57°C for 90 seconds for primer annealing and 72°C for 1 minute for extension. This program was followed by a final extension step at 72°C for 10 minutes. A clear amplified product of the expected site was considered as a positive result for that site.
The reaction products were then analyzed by electrophoresis
on a 1.5% agarose gel (Sigma, USA). If a
deletion was observed, a second identical reaction was
run to confirm the deletion in the presence of a positive
control for that deletion. All primer sequences, the
location of markers and the size of PCR products are
shown (
The mean of follicle-stimulating hormone (FSH), luteinizing hormone (LH) and testosterone and sperm parameters were compared between groups using the t test (one-way ANOVA test considering number of the groups). P<0.05 was considered statistically significant.
Details of primers, sequence-tagged sites (STS) location and polymerase chain reaction product sizes
| Primer name | Sequence (5'-3') | Product size | Location | Acession number | Position |
|---|---|---|---|---|---|
| F: GTCTTGTTGCAGCCCATGTA | 495 bp | sY1301 | BV679198.1 | Yp11.2 | |
| R: CAAAGGGAGAACTAGCAGGC | |||||
| F: AGAAGGGTCTGAAAGCAGGT | 326 bp | DYS273 | G12019 | Yq11.1 | |
| R: GCCTACTACCTGGAGGCTTC | |||||
| F: GTGACACACAGACTATGCTTC | 320 bp | DYS148 | G49207 | Yq11.21 | |
| R: ACACACAGAGGGACAACCCT | |||||
| F: GGCTCACAAACGAAAAGAAA | 274 bp | DYS218 | G11998 | Yq11.222 | |
| R: CTGCAGGCAGTAATAAGGGA | |||||
| F: GTCTGCCTCACCATAAAACG | 301 bp | DYS224 | G12001 | Yq11.222 | |
| R: ACCACTGCCAAAACTTTCAA | |||||
| F: GGGTGTTACCAGAAGGCAAA | 380 bp | DAZ1 | G38349 | Yq11.223 | |
| R: GAACCGTATCTACCAAAGCAGC | |||||
| F: GTTACAGCATTCGGCGTGAT | 126 bp | DAZ | G65827 | Yq11.223 | |
| R: CTCGTCATGTGCAGCCAC | |||||
| F: GAATATTCCCGCTCTCCGGA | 472 bp | SRY | G38356 | Yp11.3 | |
| R: GCTGGTGCTCCATTCTTGAG | |||||
The 100 fertile men had a mean age of 29.67 ± 6.17 while the 97 infertile men with oligozoospermia or azoospermia had a mean age of 35.13 ± 7.7. No YCD was detected in the 100 fertile men. Twenty (20.6%) infertile men had YCD on their Yq. Of the observed YCD, AZFc was the most frequent (15 YCD-positive cases (75%), followed by AZFbc (four YCD-positive cases (20%) and AZFabc (singleton (5%).
We classified the infertile men who had ART based on
presence/absence of YCD and clinical pregnancies into
three groups. Number of participants and ART outcome
results are shown (
Classification of the infertile men based on presence/absence of YCD and clinical pregnancy after ART
| Infertile men | Participants | Fertilization |
|---|---|---|
| CP in the absence of YCD | 42 | 42 |
| No CP in the absence of YCD | 35 | 33 |
| No CP in the presence of YCD | 20 | 0 |
ART; Assisted reproductive technology, CP; Clinical pregnancy, and YCD; Y chromosome deletion. Values are presented as counts.
Sperm parameters, documented by semen analyses, of
the three infertile groups and their hormonal profiles for
the FSH, LH and testosterone are shown (
Microdeletions of the AZF region on the long arm of
Y chromosome are one of the most important genetic
causes of male infertility, which is manifested commonly
as severe oligozoospermia and NOA (
There have been several studies reporting the prevalence
of YCD in Iran, however, some discrepancies exist
(
Sperm parameters and hormonal profiles of the infertile men in three groups
| Infertile men | Volume (ml) | Count (×106/ml) | Motility (%) | Morph (%) | FSH (mIU/ml) | LH (mIU/ml) | Testosterone (ng/dl) |
|---|---|---|---|---|---|---|---|
| CP and no YCD | 3.72 ± 1.9 | 9.59 ± 1.8 | 23.64 ± 18.8 | 9.23 ± 6.1 | 4.8 ± 3.17 | 3.76 ± 2.5 | 4.53 ± 1.3 |
| No CP and no YCD | 3.29 ± 1.67 | 7.35 ± 1.8 | 20.91 ± 19.3 | 9.55 ± 5.4 | 10.83 ± 7.23 | 8.29 ± 7.8 | 6.63 ± 5.5 |
| No CP and presence of YCD | 4.17 ± 1.3 | 0 | 0 | 0 | 28.45 ± 22.2 | 8.56 ± 3.71 | 4.4 ± 2.6 |
| P value | 0.476 | 0.064 | 0.003* | 0.45 | 0.023* | 0.31 | 0.53 |
CP; Clinical pregnancy, YCD; Y chromosome deletion, Morph; Morphology, FSH; Follicle stimulating hormone, LH; Luteinizing hormone, and Testost; Testosterone. Values are presented as mean ± SD. *P<0.05 is significant.
In our study, YCD was detected in 20.6% of infertile
men, among which the AZFc region deletions was the
most frequent, comprising 75% of all deletions. These
results are in agreement with previous reports in Iran
and other countries (
Previous studies have nevertheless shown that ICSI results
are worse for men with NOA compared with men
with obstructive azoospermia (
It is reported that with complete deletion of AZFa and AZFb, TESE is usually not successful for sperm harvesting. Interestingly, one of our NOA patients who carried a complete AZFabc deletion had successful sperm retrieval by TESE. Although his retrieved sperm did not result in a successful fertilization, this finding shows that the results of YCD tests can not always predict the failure of sperm retrieval by TESE. We believe that ICSI failure in the YCD-positive sub-group in this study is likely due to their profound testicular failure which is reflected by their high mean FSH level (28.45 ± 22.2 mIU/ml).
All patients with YCD were azoospermic and had
failed fertilization results after TESE and ICSI. There
are several reports demonstrating a lower fertilization
rate in patients with YCD compared with infertile men
without any deletions (
We observed a much higher FSH level in the group
with YCDs compared with the other two groups. The
appropriate induction and maintenance of sperm production
is dependent on appropriate serum FSH levels. It has
been shown that azoospermic men with FSH levels =20
IU/L have lower chances of having live-born children
with the ICSI method (
Our second infertile group did not have any CP in spite of proceeding to the fertilization stage in 33 out of the 35 cases (94%) and being YCD-negative . Possibility of other concurrent causes of infertility such as poor oocyte quality in the two individuals who did not have fertilization should be considered. In the remaining 33 individuals, implantation issues may be a possible explanation for the failure of clinical pregnancy in fertilized oocytes.
Future studies regarding YCD frequencies and ART outcomes with larger sample sizes, in seprated ethnic groups are strongly recommended. Moreover, investigation of AZFc sub-mutations may lead to valuable insights. Also, evaluation of any probable correlation between YCD and histopathological results might add further insights.
YCD had a relatively high frequency among NOA men in our study. This result confirms the necessity of YCD screening for infertile men and appropriate patient counseling before ART.
)
