1
Department of Anatomical Sciences, Tehran University of Medical Sciences, Tehran, Iran
2
Stem Cells Technology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran;Shiraz Institute for Stem Cells and Regenerative Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
Background Oocyte cryopreservation is an essential part of the assisted reproductive technology (ART), which was recently introduced into clinical practice. This study aimed to evaluate the effects of two vitrification systems-Cryotop and Open Pulled Straw (OPS)-on mature oocytes gene expressions. Materials and Methods In this experimental study, the survival rate of metaphase II (MII) mouse oocytes were assessed after cryopreservation by vitrification via i. OPS or ii. Cryotop. Then we compared the fertilization rate of oocytes produced via these two methods. In the second experiment, we determined the effects of the two vitrification methods on the expression of Hspa1a, mn-Sod, and ß-actin genes in vitrified-warmed oocytes. Denuded MII oocytes were vitrified in two concentrations of vitrification solution (VS1 and VS2) by Cryotop and straw. We then compared the results using the two vitrification methods with fresh control oocytes. Results mn-Sod expression increased in the vitrified-warmed group both in OPS and Cryotop compared with the con- trols. We only detected Hspa1a in VS1 and control groups using Cryotop. The survival rate of the oocytes was 91.2% (VS1) and 89.2% (VS2) in the Cryotop groups (P=0.902) and 85.5% (VS1) and 83.6% (VS2) in the OPS groups (P=0.905). There were no significant differences between the Cryotop and the OPS groups (P=0.927). The survival rate in the Cryotop or the OPS groups was, nevertheless, significantly lower than the control group (P < 0.001). The fertilization rates of the oocytes were 39% (VS1) and 34% (VS2) in the Cryotop groups (P=0.902) and 29 %( VS1) and 19.7% (VS2) in the OPS groups (P=0.413). The fertilization rates were achieved without significant differences among the Cryotop and OPS groups (P=0.755). Conclusion Our results indicated that Cryotop vitrification increases both cooling and warming rates, but both Cryo- top and OPS techniques have the same effect on the mouse oocytes after vitrification.
Oocyte cryopreservation is an essential part of the assisted
reproductive technology (ART), which has been recently
introduced into clinical practice. Additionally, this
method is useful for the preservation of female genetic
resources through oocyte banking (1, 2). The cryopreservation
of the mammalian oocyte has proven to be more
difficult than other cell types because of its sensitivity
towards ice crystal formation and the sensitivity of meiotic
spindle to changing temperature during the process of
freezing and thawing (3). The freezing and thawing cause
meiotic spindle destruction; therefore, it is essential to
incubate the oocytes for 3-5 hours post-warming. Then,
the meiotic spindle can regenerate (4, 5). Vitrification is a
practical method that produces a glass-like solidification
of the cells by rapid cooling and high concentrations of
cryoprotective agents (CPAs). Consequently, this method
can decrease the formation of ice-crystals and cell injury
(6, 7).
Different types of cryoprotectants are used for vitrification
protocols, including ethylene glycol (EG),
dimethyl sulfoxide (DMSO), and 1, 2-propanediol
(PrOH). EG is a common CPA that is used for oocyte
vitrification. DMSO and PrOH are used regularly as
permeating CPAs to cryopreserve oocytes and embryos
to prevent the intra-cellular ice crystal formation. The
combinations of CPAs can decrease the concentration
of each CPA, as well as diminishing the toxic effects of
CPA on the oocytes (8, 9). Non-penetrating CPAs, such
as sucrose, are often used in combination with other
permeating CPAs to prevent ice crystal formation and
decease the CPA toxicity (10).
There are many vitrification devices that increase
the cooling rate, such as cryoloop, solid surface (11),
Cryotop (12), and open pulled straw (OPS) (13). The
Cryotop consist of a hard plastic and a fine thin filmstrip
(14). The minimum amount of vitrification solution
(~0.1 µl) remaining in Cryotop is in direct contact
with liquid nitrogen during cooling. As a result,
ice crystal formation is prevented due to dramatically
increased cooling rate (12). OPS vitrification is another
popular method for human oocyte and embryo
vitrification (15-17). OPS has a small effect for reducing
the volume of vitrification solution to 0.5 µl and
thus increasing the cooling rate (18). In recent studies,
the advantages of Cryotop was compared with
OPS in different species, including pig (19), human
(20), and matured bovine oocytes (15). However, additional
information is required to identify the effect
of these two devices on mouse oocytes (21).
Other studies have reported that the structural and morphological
injures occur in the vitrified-warmed oocytes. These
include zona hardening, variation in selective permeability
of plasma membrane, aneuploidy, and nuclear fragmentation
(8, 6, 22). Vitrification may also result in changes at the
molecular level in vitrified oocytes. Heat shock protein (Hsp)
a1a and the manganese super oxide dismutase (mn-Sod)
are two critical genes related to stress. Hsps play a protective
function against heat, stress response, or both in
cellular auto-regulation. The critical role of Hspa1a, as a
defensive protein resulting from external stress, has been
proven. It is confirmed that knock-out Hsp70.1 mice have
higher sensitivity to osmotic stress after preconditioning
them with heat (23, 24).
Hut et al. (25) showed that Hspa1a has a protective effect
on the mitotic cell cycle against heat-induced centrosome
damage, preventing chromosomal division. Mn-Sod
is an anti-oxidant enzyme that protects the oocytes and
embryos against the oxidative stress damages. It was
stated that adding antioxidant enzymes such as catalase
or Sod1 (Cu-Zn-Sod) to culture media leads to an improved
rate of blastocyst formation in rabbit (26), and
mouse (21). Sonna et al. (27) reported that cold stress can
influence the expression of genes associated with stress
(stress-response genes).
In this study, the effect of vitrification protocols on the
oocyte’s gene expression was investigated using mature
mouse oocytes. Hence, the efficiency of the two vitrification
methods (OPS vitrification to Cryotop method) was
compared on fertilization percentage, morphological survival,
and gene expression of Hspa1a and mn-Sod in the
mouse oocytes.
Materials and Methods
The present experimental study was conducted using
mouse oocytes and sperm. The study protocol was
approved by the Research Ethics Committee of Tehran
University of Medical Sciences. All chemicals and media
were purchased from Sigma-Aldrich Co (St.Louis, Mo,
USA), unless otherwise mentioned.
Experimental design
The fertilization rate of metaphase II (MII) mouse oocytes
was assessed after cryopreserving by vitrification
using: i. OPS or ii. Cryotop. In the second experiment, we
determined the effects of two vitrification methods on the
oocytes gene expression.
Experiment 1
Mature oocytes were randomly selected and distributed
amongst three experimental groups (OPS, Cryotops,
and controls). All vitrification groups were divided into
VS1 (10% v/v cryoprotectants) and VS2 (14.5 %v/v cryoprotectants)
subgroups and a total of 119 and 114 were
OPS-vitrified in VS1 and VS2. Also, 135 and 136 were
cryotop-vitrified in VS1 and VS2; finally, 136 oocytes
were used as controls. After vitrification and warming, the
oocytes in all groups were fertilized and cultured in vitro.
Experiment 2
The oocytes were analyzed by reverse transcription-
polymerase chain reaction (RT-PCR) to evaluate changes
in Hsp70 and mn-Sod expression in all groups.
Oocyte collections
Female NMRI mice aged 8 to 10 weeks were kept under
12 hours of light/dark condition. The female mice were
superovulated by intraperitoneal (i.p.) injection of 10 IU
pregnant mare’s serum gonadotropin (PMSG), followed
by i.p. injection of 10 IU human chronic gonadotropin
(hCG) 48 hours later. The mice were sacrificed by cervical
dislocation 13-15 hours post-hCG administration (6).
The cumulus-oocyte complex (COC) were collected from
the oviduct and oocytes denudation were performed using
300 µg/ml hyaluronidase in hepes-buffered TCM199
for 30 seconds. The normal mature oocytes were selected
with first polar body, intact zona pellucida, and plasma
membrane.
Preparation of vitrification and dilution solution
TCM199 supplemented with 20% fetal bovine serum
(FBS) were used as a base medium. The first vitrification
solution (VS1) consisted of 10% EG, 10% DMSO, and
0.5 M sucrose in the base medium (21). The second vitrification
solution (VS2) was contained 14.5% EG+14.5%
PrOH and 0.5 M sucrose in the base medium. The equilibration
solution included (ES1) 5% EG and 5% DMSO
without sucrose in the base medium and the second equilibration
solution (ES2) contained 7.25% EG+7.25% PrOH
without sucrose in the base medium. Warming solution
(WS) contained 1 M sucrose in the base medium, and diluents’
solution (DS) contained 0.5 M (DS1) and 0.25 M
(DS2) sucrose, respectively. All vitrification process steps
were performed at room temperature (25°C) (13, 15).
Occyte vitrification/warming
The COC were isolated from 32 female mice by simple
random sampling. Then, the denuded MII oocytes were vitrified
in two concentrations of VS1 and VS2 by Cryotop and
OPS (13). Oocytes at VS1, VS2, and control groups were
exposed to the first equilibration drop for 3 minutes and
then the first drop was merged with adjacent ES drop. Subsequently,
the oocytes were incubated in vitrification solution,
VS1 and VS2, each one for less than 1 minute. Every
five oocytes were quickly loaded on the top of per Cryotop
(Kitzato, Ltd, Japan, Cryotop group) or loaded into OPS. Excess
media were carefully removed around the oocyte in the
Cryotop and then immediately submerged in liquid-nitrogen
(LN2). OPS was also sealed and plunged directly into LN2.
The oocytes were stored in LN2 for 7 days.
During warming, the Cryotop was immediately inserted
into WS at 37°C for 1 minute (Cryotop group) or the straw
was taken out and immersed into 37°C water for 30 seconds.
The straw end was cut and its contents were transformed
into a drop of 1 M sucrose (straw group). Then, the oocytes
were placed onto decreasing sucrose concentrations (DS1
and DS2) to remove cryoprotectants, for 3 minutes each.
Finally, the warmed oocytes were washed twice in the base
medium using WS, each time for 5 minutes (Fig .1). We assessed
the survival rates of vitrified-warmed oocytes on the
basis of normal appearing zona pellucida and intact polar
body (Fig .2). After warming, groups of 15 oocytes were
stored at -80°C in Tripure isolation reagent for RNA extraction
and groups of 15 oocytes were also incubated in the
base medium before in vitro fertilization (IVF).
A schematic of vitrification and warming procedure.
Morphology of vitrified MII oocytes after warming. Oocyte vitrified in two vitrification solution (VSI and VSII) by OPS and Cryotop. A. Control, B. VSI, Cryoptop,
C. VSII, Cryotop, D. VSI, OPS, and E. VSII, OPS 20 U means 20 micron).
MII; Metaphase II, VS; Vitrification solution, and OPS; Open Pulled Straw.
The Primer sequences for reverse transcription-polymerase chain reaction
Gene
Gene bank accession number
Primer sequencing (5ˊ-3ˊ)
Annealing temperature (ºC)
Location
Size bp
ß-actin
NM_001101
F: tcatgaagatcctcaccgag
60
650-839
190
R: ttgccaatggtgatgacctg
Sod2
NM_001024466.1
F: ggaagccatcaaacgtgact
55
237-398
161
R: ccttgcagtggatcctgatt
Hspa1a
ENST00000375651
F: cgacctgaacaagagcatcaac
59
668-862
194
R: tgaagatctgcgtctgcttggt
In vitro fertilization
The vitrified/warmed oocytes with intact zona pellucida,
intact plasma membrane plus homogeneous cytoplasm
were chosen and placed in 200 µl drops of IVF medium
[human tubal fluid (HTF)+15 mg/ml bovine serum albumin
(BSA)] layered under mineral oil (Sigma, 8410). The
medium was prepared earlier to equilibrate and incubated
at 37°C in 5% CO2 for 2 hours. A suspension of epididymal
spermatozoa was prepared and the sperms were capacitated
in the medium (HAM's F10+4 mg/ml BSA) at 37°C in 5%
CO2 for 45-60 minutes. A final concentration of 2×106 spermatozoa/
ml was added to IVF medium containing 15 oocytes
and incubated at 37°C in 5% CO2 for 6 hours. Finally,
the oocytes that developed into pronuclear stage were used
for fertilization.
RNA isolation and reverse transcription
Total RNA was extracted from the vitrified and non-
vitrified oocytes. A number of oocytes were lysed with
Tripure isolation reagent (Roche, Germany), according
to the manufacturer’s instructions. The concentration
and purity of the extracted RNA were determined
by ND-1000 spectrophotometer (Nanodrop, USA). To
synthesize cDNA, we used 300 ng/µl of total RNA and
cDNA Synthesis Kit (Bioneer, South Korea) by following
the manufacturer’s protocols.
Polymerase chain reaction
RT-PCR was performed using Taq polymerase enzyme
(Roche). Reactions (25 µl) contained 1 µl of each primer
mix, 2 µl dNTP, 2.5 µl 10X buffer with MgCl2, 0.3 µl
rTaq polymerase enzyme, 1 µl cDNA, and 18.2 µl DEPC
water in every well. The initial denaturation step was 3
minutes at 94°C and then denaturation in each cycle was
30 seconds at 94°C. Then annealing was done for 30 seconds
at 55°C for mn-Sod, and 59°C for Hspa1a and it
was extended for 1 minute at 72°C. Expression of ß-actin
housekeeping gene was used as a reference for the level
of target gene expression.
PCR primers were designed using primer 3 software
based on mouse DNA sequences found in the
Gene Bank (NCBI) (Table 1) (28). The primers were
placed into BLAST search to examine the aligned sequences
for polymorphisms and avoided these regions
for primers or probe design. RT-PCR products were
electrophoresed on a 2% agarose gel. After stained by
ethidium bromide (Cina Gene), the products were then
visualized under ultraviolet. The no template control
(NTC) includes all the RT-PCR reagents except that the
template was considered as a negative control. A run on
2% agarose and no DNA band was also visualized (data
was not shown).
Statistical analysis
Oocyte survival and fertilization rates were analyzed
by SPSS version 16 software package. All percentages
of values were subjected to arcsine transformation prior
to analysis. All data were expressed based on mean
± SEM. The level of statistical significance was set at
P<0.05.
Results
Vitrification and in vitro fertilization
The survival of the vitrified/warmed oocytes were
assessed according to their morphology in the control,
the Cryotop, and the OPS groups (Fig .2). There
was no difference in oocyte survival between the VS1
group and the VS2 group when using the Cryotop
method. Similarly, there was also no significant difference
in oocyte survival between the VS1 and the
VS2 group when oocytes were vitrified by the OPS
method (P=0.905). There were also no significant differences
in oocyte survival between oocytes vitrified
by the Cryotop and the OPS methods within the same
vitrification solution group (P=0.927). The survival
rate in the Cryotop or the OPS groups was, nevertheless,
significantly lower than the control group
(P<0.001).
The results showed a significant reduction in the
fertilization rate of each group in comparison with
the control (P<0.05). There is also no significant difference
in oocyte fertilization between the VS1 and
the VS2 group when oocytes were vitrified by Cryotop
(P=0.902). There is also no significant difference
in oocyte fertilization between the VS1 and VS2 the
group when oocytes were vitrified by OPS method
(P=0.413). The fertilization rates were achieved without
significant differences among the Cryotop and the
OPS groups (P=0.755, Table 2).
Effects of two different vitrification solutions on the survival and the fertilization rate of the MII oocytes
Survival Mean ± SEM
Fertilization Mean ± SEM
Device
Control
Cryotop
OPS
Control
Cryotop
OPS
Control
100 ± 0.001
88.0 ± 2.3 (131/136)
VS1
91.2 ± 6.7
85.5 ± 1.2
39.0 ± 5.8 (58/135)
29.2 ± 2.4 (57/119)
VS2
89.2 ± 6.1
83.6 ± 1.19
34.0 ± 5.7 (48/133)
19.7 ± 2.3 (49/114)
P value
0.004
0.001
Tukey’s method was used for multiple comparisons. No significant differences were detected amongst the treatment groups (P<0.05). The experiments were replicated 3 times.
MII; Metaphase II, VS; Vitrification solution, and OPS; Open Pulled Straw.
Gene expression analysis
Cryotop groups
The expression of all genes in the vitrified-warmed oocytes
in Cryotop was compared to the control (Fig .3). RT-
PCR was prepared to investigate the alternation in gene
expressions. The abundance of mRNA declined in the
oocytes as a by-product of the vitrification procedures,
but the expression of mn-Sod increased in the vitrified-
warmed oocytes in comparison with the control group.
We also detected Hspa1a in the control and VS1 in the
Cryotop group.
The expression of Hspa1a and mn-Sod genes was examined by reverse
transcriptase- polymerase chain reaction; then, products run on 2
percent agarose gel (Cryotop groups). M; Marker, c; Control, and VS; Vitrification
solution.
Open Pulled Straw groups
The expression of Hspa1a and mn-Sod was assessed in
the OPS group and compared to the control group. The results
presented in Figure 4 show that Hspa1a was expressed
in the VS1, the VS2; and the control groups, but mn-Sod
was expressed only in the VS1 and the VS2 groups.
The expression of Hspa1a and mn-Sod genes was examined by reverse
transcriptase- polymerase chain reaction; then, products run on 2%
agarose gel [Open Pulled Straw (OPS) groups]. M; Marker, c; Control, and VS; Vitrification solution.
Discussion
In the present study, we observed that the Cryotop or
the OPS changed the expression levels of a Hsp70 family
(Hspa1a), and an antioxidant enzyme (mn-Sod) in the vitrified-
warmed MII-oocytes. The results showed that there
were no a significant differences between the quality of
the Cryotop and the OPS methods in the morphology and
the fertilization rates in mouse MII oocytes. Significant
decreases in the fertilization rate of the vitrified-warmed
oocytes compared to the control in both the VS1 and the
VS2 groups were observed regardless of the vitrification
methods.
Optimal cryopreservation can be achieved by limiting
the two essential factors in various vitrification protocols:
chilling injury and ice formation (15). To minimize the
chilling injury, the vitrification procedure can use high
cooling rate. This can be achieved by minimizing the volume
of vitrification solution and direct contact between
the sample and liquid nitrogen. Furthermore, in the vitrification
protocol, high concentrations of CPAs were used
to avoid ice crystal formation, but the cytotoxicity and the
osmotic stress were increased. Permeating cryoprotectants
were used to prevent intracellular ice crystal formation.
Therefore, the use of various CPAs combinations can
be efficient in reducing the concentration and the individual-
specific toxicity of each CPA (29).
Vitrification process can induce stress. Hence, it is critical
to choose an appropriate approach in order to minimize
oxidative, osmotic, and heat stress (23). In this
study, we attempted to increase the cooling rate by using a
minimum volume cooling method (Cryotop) or the OPS,
and then compare them with each other. It has been demonstrated
that a high cooling rate reduces the toxicity of
high CPAs concentrations, thus minimizing the oxidative
stress and also improving the efficiency of cryopreservation
(18, 30). In this study, we compared the Cryotop
and the OPS vitrification, two popular minimum volume
vitrification methods that provide high cooling rates, for
mouse oocyte cryopreservation. The results demonstrated
that the efficacy of both methods to allow mouse oocytes
to undergo normal fertilization after warming.
Cryotop vitrification has been a widely used method for
oocyte vitrification. Previously, we reported that using the
Cryotop vitrification with a mixture of 15% EG and 15%
DMSO is beneficial for vitrifying oocytes (30). Chian et
al. (8) and Habibi et al. (31) also obtained a high survival
rate of in vitro matured bovine oocytes vitrified by the
Cryotop method using various combination of CPAs. In
this study, oocytes vitrified by the Cryotop method resulted
in a higher survival rates compared with those vitrified
by OPS method. However, the differences were not significant.
These results were in agreement with a previous
report that compared the two vitrification methods (the
Cryotop and the OPS) using calf and cow oocytes with
different combinations of CPAs (15).
In addition to evaluating the effects of the vitrification
methods on the oocyte viability, we also assessed the
Hsp70 and mn-Sod expression in the oocytes vitrified by
the OPS or the Cryotop. Based on the works done on the
animal models, reduced fertilization rate and low competency
of the oocytes after warming may be associated
with alternation in expressions of antioxidant enzymes
and also hereditary factors in the oocytes (32, 33), as well
as the toxicity of cryoprotectants. The development of
the oocytes is dependent on the presence of specific transcripts
(34).
The selected genes were involved in response to stress
(mn-Sod, and Hspa1a). Changes in gene expression are
considered as an integral part of cellular response to thermal
stress. It is widely accepted that Hsps, whose expression is
affected by heat shocks, are the best candidate. It was recently
indicated that thermal stress can induce expression in
a number of non-Hsps genes like mn-Sod (25, 29).
Hspa1a is a member of the inducible heat-shock family
that can protect the oocytes against oxidative stress (35).
In the present study, we only detected Hspa1a in the control
and the VS1 group in the Cryotop groups, but Hspa1a
was expressed in both the VS1 and the VS2 as well as
the controls in the OPS groups. Boonkusol et al. (36) reported
a similar result after vitrification with straw. The
difference in gene expression observed in present study
suggests that different vitrification methods may in affect
the oocytes differently at the molecular level.
Oxidative stress may weaken the intracellular function
and affect further development of the oocytes. Oxidative
stress caused DNA instability in the mouse oocyte (37).
Moreover, Bilodeau et al. (38) reported that during cryopreservation,
the activity of Sod was reduced by 50%
in bovine spermatozoa. Therefore, high expression of
mn-Sod in the vitrified-warmed oocytes can be a defense
mechanism against oxidative stress. In the present study,
the expression of mn-Sod was increased in both the VS1
and the VS2 in the Cryotop and the OPS groups. We found
that the survival rate and the developmental competence
of the mouse MII oocytes after being vitrified both in 10%
EG+10% DMSO mixture and 14.5% EG+14.5% PrOH in
the Cryotop and the OPS groups showed the same effects.
Conclusion
Our findings confirmed that the Cryotop and the OPS both
can be a good candidate in mouse oocytes vitrification. It is
crucial to perform further studies focusing on the expression
patterns of the genes involved in early differentiation stages.
Amidi, F., Khodabandeh, Z., Nori Mogahi, M. (2018). Comparison of The Effects of Vitrification on Gene Expression of Mature Mouse Oocytes Using Cryotop and Open Pulled Straw. International Journal of Fertility and Sterility, 12(1), 61-67. doi: 10.22074/ijfs.2018.5112
MLA
Fardin Amidi; Zahra Khodabandeh; Mohamad Hossain Nori Mogahi. "Comparison of The Effects of Vitrification on Gene Expression of Mature Mouse Oocytes Using Cryotop and Open Pulled Straw". International Journal of Fertility and Sterility, 12, 1, 2018, 61-67. doi: 10.22074/ijfs.2018.5112
HARVARD
Amidi, F., Khodabandeh, Z., Nori Mogahi, M. (2018). 'Comparison of The Effects of Vitrification on Gene Expression of Mature Mouse Oocytes Using Cryotop and Open Pulled Straw', International Journal of Fertility and Sterility, 12(1), pp. 61-67. doi: 10.22074/ijfs.2018.5112
VANCOUVER
Amidi, F., Khodabandeh, Z., Nori Mogahi, M. Comparison of The Effects of Vitrification on Gene Expression of Mature Mouse Oocytes Using Cryotop and Open Pulled Straw. International Journal of Fertility and Sterility, 2018; 12(1): 61-67. doi: 10.22074/ijfs.2018.5112