1
Department of Biochemistry, Fasa University of Medical Sciences, Fasa, Iran
2
Department of Medical Genetics, Infertility and Reproductive Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3
Department of Community Medicine, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4
4Monoclonal Antibody Research Center, Avicenna Research Institute, ACECR, Tehran, Iran
5
5Nanobiotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran
Abstract
Background: Fatty acid binding proteins (FABPs) are members of the intracellular li- pid binding protein (iLBPs) family and most of them show tissue specific expression. FABP9/PERF15 (Perforatorial15) is the male germ cell-specific fatty acid-binding pro- tein. It was first identified as the major constituent of the murine sperm perforatorium and perinuclear theca. To date, investigations in mice have demonstrated that this protein has a role in the male reproductive system, especially in spermatogenesis. Also, it has been reported that FABP9 can protect sperm fatty acids from oxidative damage. Recently it was shown that it can affect sperm morphology in mice. Based on these findings, we designed a study to evaluate if mutations of this gene can affect sperm morphology in humans. Materials and Methods: In this case-control study, DNA was extracted from peripheral blood of 100 infertile males with normal sperm count but with a number of morphologi- cally abnormal sperms in their semen that was above normal. Four exons and one intron of the FABP9 gene were amplified by polymerase chain reaction (PCR), re-sequenced and then analyzed for mutation detection. Results: We did not detect any mutation in any area of the four exons, intron 3 and splice sites of FABP9 gene in any of the studied 100 samples. Conclusion: There was no mutation in the exonic regions and the poor sperm mor- phology. However, we didn’t analyze the promoter, intron 1 and 2 to establish conclusions regarding the association of these genic regions and sperm dysmor- phology.
Fatty acid binding proteins (<italic>FABPs</italic>) are a group
of proteins which can bind to fatty acids, specially
long chain (C12-20), which differ in their selectivity,
affinity and binding mechanisms (1, 2). They
are members of the intracellular lipid binding proteins
(iLBPs) family and most of them show tissue
specific expression. FABPs are structurally cytosolic
proteins and demonstrate strong evolutionary conservation
(3). To date, 10 FABP coding genes have been
identified in the human genome. Numerous functions
have been demonstrated for FABPs such as intracellular
fatty acid trafficking, fatty acid metabolism, signal
transduction, cell growth and differentiation, and
regulation of gene expression (1, 3-6). FABP9 (also
known as <italic>T-FABP</italic> or <italic>PERF15</italic>) is a poorly understood
member of the FABP family which is located on chr.
8q21.13. FABP9 was first identified as a major component
of the rat sperm perinuclear theca (7). FABP9
has the highest homology with myelin P2, and it has
been suggested that it may share some functions with
the myelin P2 protein. FABP9 is expressed during
spermatogenesis in mammalian testis (7, 8) and it has
been proposed that FABP9 has a role in the apoptosis
of these cells (9). Another study has demonstrated that
it can protect sperm fatty acids from oxidation, thus
maintaining their ability to fertilize oocytes (10).
The mammalian sperm is a vital cell in reproduction
and its intact function is essential. There are many
problems that can affect sperm physiology; it can be
functional defects, numerical defects or morphological
defects of this cell. A recent study by Selvaraj et al.
(11) demonstrated that mice deficient in FABP9, are
fertile but they show increased morphological defects
in their sperm structure relative to wild type mice.
There have been no investigations regarding the role
and function of FABP9 in humans however, according
to the evidence in mice; FABP9 is likely to have
a role in the male reproductive system, especially in
the function and the structure of sperm. In the present
study, we hypothesized that this protein has a role in
human spermatogenesis and mutations in this gene
may cause sperm morphological defects. Our study
was designed to evaluate this hypothesis.
Materials and Methods
Study population
In this case-control study, normal and patient human
samples were collected from the individuals
according to a formal agreement when referring to
Avicenna Research Institute. All human studies have
been reviewed by the appropriate
Ethics Committee.
From patients who were referred to the Avicenna
fertility and infertility center, Tehran, Iran, 100 men
who had fulfilled our criteria were randomly selected.
These men were infertile and their sperm count was
normal but their semen analysis showed more than
30% (according to the WHO criteria) morphologically
defective sperm. These men had normal karyotype
and the cause of infertility and defective sperm
morphology was unknown.
Men with anatomical defects in the reproductive
system, genetic syndromes (e.g. XXY), oligozospermia
and azospermia, as well as couples for
which the cause of infertility was a female factor
were excluded from our study. Anthropometric
parameters including age, body height and weight
were all recorded. A complete semen analysis was
carried out for each subject.
A population of 100 fertile men who had children
was also selected as the control group. Since first
we tested infertile cases and found no mutation in
the gene, there was no need to study the same regions
of the gene in fertile healthy subjects.
Sampling method was purposive, data was processed
by statistical product and service solutions
(SPSS16) and analyzed by χ2 test.
DNA extraction
Peripheral blood samples was obtained from
each subject. DNA was extracted from all samples
using a salting out method.
Polymerase chain reaction (PCR)
FABP9 contains 4 exons and 3 introns. Three
pairs of primers were designed to amplify all 4
exons. As exons 3 and 4 and the intron between
them are short in length, only one pair of primers
was designed to amplify this sequence. Primers
were designed using Primer blast software (http://
www.ncbi.nlm.nih.gov/tools/primer-blast). The
primers and the size of the amplified sequence are
as follows: for exon 1 forward: 5ʹ CTACTGGCAGCACCGTAATG
3ʹ, reverse: 5ʹ CCCTAGGATCACAAAAGGAAG
3ʹ, 259 bp, for exon 2 forward: 5ʹ
GAAAATTGACTTCCAGAGTGATTG 3ʹ, reverse:
5' AACCATGCCTAACCACCTT 3', 306 bp, for
exon 3 and 4: forward: 5' TGTGGTCTCATGTAGGTTAGAAGG
3', reverse: 5' TCTTCAGGTACCAGTTCCTTGTC 3', 440 bp. The PCR reaction was
performed in 25 μl volume containing 100-300 ng
of extracted DNA, 1X PCR buffer (50 mM KCl;
10 mM Tris-HCl; 1.5 mM MgCl<sub>2</sub>), 2 mM MgCl2,
200 μM dNTP mix and double distilled water was
added up to 25 μl with 1 U of Taq DNA polymerase
(super Taq DNA polymerase, Gen Fanavaran co.,
Tehran, Iran) and 0.4 μM of each oligoneucleotide
primer. PCR products were loaded on 1% agarose
gel followed by ethidium bromide staining to confirm
the detected amplified fragments.
Sequencing
After confirming the PCR reaction and purification,
PCR products were sequenced using an ABI
3730XL DNA Analyzer manufactured by Applied
Biosystems (Bioneer, South Korea). The results of
DNA sequencing were analyzed by Chromas software
(version 2.33 Technelysium Pty Ltd) and the
results were compared with the reference sequence
using national center for biotechnology information
(NCBI) blast software (http://blast.ncbi.nlm.
nih.gov).
Polymerase chain reaction-restriction fragment
length polymorphism
We also analyzed the frequency of a single nucleotide
polymorphisms (SNP, rs28485205) located
at intron 3 of the FABP9 gene between case
and control groups using the polymerase chain reaction-
restriction fragment length polymorphism
(PCR-RFLP) method. The primers were the same
as primers used for amplification of exons three
and four. 5 μl of each PCR product was digested
with 1U of AluI restriction enzyme (Jena Bioscience
EN-101S) at 37˚C for about 1 hour. The enzyme
cuts when the nucleotide in this site is G but
not when there is an A. The original PCR product
is 440 bp lengths, therefore, if the enzyme cuts,
there will be 2 fragments of 306 bp and 134 bp.
Results
The result of PCR amplification of the whole
gene except introns 1 and 2 and the promoter region
was three distinct fragments (Fig 1). A 259
bp segment contains exon1; the 306 bp fragment
bearing exon2 and the 440 bp contains the exons
3&4 in addition to the third intron sequences of
FABP9. PCR-RFLP for SNP (rs28485205) in the
third intron showed that the region was digested by
AluI restriction enzyme resulted in three different
bands in heterozygote pattern but produced only
two bands of distinct molecular weight in homozygote
samples (Fig 2).
PCR amplification. Fragments of the gene were detected
after electrophoresis on 1% agarose gel. Columns
1and 4: exon1, columns 2 and 5: exon2, and columns 3 and
6: exons3, 4 and intron3. Column 7 is 100 bp size marker.
PCR-RFLP result. PCR products were digested by
AluI and electrophoresed on 2% agarose gel stained by
ethidium bromide. Lanes 1, 2 and 4 are heterozygotes for
the polymorphism A>G with three distinct bands of 440, 306
and 134 bp. Lanes 3 and 5 are homozygote pattern for the
single nucleotide polymorphism with two different bands of
306 and 134 bp.
All 4 exons of FABP9 gene were sequenced
in each of 100 patient samples. No mutation
was detected in the four exons, intron 3 and
splice sites of the FABP9 gene in these 100
samples. We detected three SNPs in the sequenced
regions of the gene in our samples in
comparison to the reference gene sequence.
The frequency and details of these SNPs are
shown in table 1.
Variants study
The present Ensemble (http:/www.ensemble.
org) database informing of 31 different variants
in the sequenced regions of the gene with
5, 10 and 16 variants with the first, second and
third primer pair regions respectively. Three of
the variants were SNPs and were seen in our
samples as rs62513549 in intron 1, rs28485205
and rs75129444 in intron3. The allele frequency
was calculated for and compared between
the three single nucleotide polymorphisms as is
demonstrated in table1.
The SNP rs28485205 allele frequency in infertile
men was compared with a normal (fertile)
group of 100 fertile individual by χ2 test with no
significant difference (p=0.458). Also, the SNP
genotype frequency was not significantly different
between the two groups (p=0.257). The results are
shown in table 2.
Genotypes and allele frequency distribution in the detected SNPs in our samples
SNP
Genotype %
Allele frequency
rs62513549
C/C
/G
G/G
C
G
88 %
11 %
1 %
93.5 %
6.5 %
rs28485205
G/G
G/A
A/A
G
A
80 %
18 %
2 %
89 %
11 %
rs75129444
G/G
G/A
A/A
G
A
99 %
1 %
0 %
99.5 %
0.5 %
Comparison of genotypes and allele frequencies of rs28485205 in fertile and
infertile groups
Group
Genotype %
Allele frequency
G/G
G/A
A/A
G
A
Fertile
86 %
14 %
0 %
93 %
7 %
Infertile
80 %
18 %
2 %
89 %
11 %
Discussion
Previous studies have shown that FABP9 has a
possible role in sperm morphology and function
(12, 13). This protein is one of the members of
FABP gene family
which is only present in the
genome of mammals
(7, 14). Moreover, it seems
that the protein could have an influence on programmed
death of spermatocytes and their development
as well as a protection role to oxidation
towards sperm fatty acids which in turn increases
fertility potential (10). A very recent study, determined
that the absence of the protein affects
mice sperm morphology (11). Based on evidence
that emphasizes that FABP9 could be effective in
spermatogenesis, sperm shaping and perhaps in
human fertility, in this study, we investigated the
presence of potential mutations in FABP9 of infertile
men which could affect the morphology and
fertility/ viability of human sperm. Although, we
did not observe any mutation in the coding regions
of study and have not investigated other relevant
regions of the gene, promoter, intron 1 and 2, yet,
the questions remain as to the role of the FABP9
product in human reproduction and its location in
the human testis.
However, there are genes which are identified to
be involved in the sperm morphology development
(globozoospermia, 15) and it seems they could be
used as gene markers. Therefore, it appears that
further genetic investigation of infertility and finding
candidate genes for genetic markers for diagnosis
of male infertility may be necessary.
Testis is a composed gonad of different compartment
and cell types. Although it is shown that
FABP9 is expressed in testis, there is no evidence
to show the specific location of the gene expression
in human testis. One possibility could be that
the protein is expressed in a different cell type of
human testis like interstitial tissue cells, compare
to the mice FABP9 expression in spermatozoa.
Then, regarding the importance of interstitial tissue
protein induction role on leydig cells which in
turn are supportive for germ cells meiosis division,
growth and synchronization, an indispensable unknown
role could be contributed to FABP9 in human
spermatogenesis procedure, respectively. Our
future plan for the human FABP9 localization will
clarify the fact.
While looking for mutations, we found several
SNP in the patient population. The allele frequency
of rs62513549 in Iranian population was close
to Utah residents with Northern and Western European
ancestry (CEU) and [Han Chinese in Beijing,
China (CHB) + (Japanese in Tokyo, Japan)
JPT] populations, rs 28485205 had a close similarity
in allele frequency between our population
and CEU while CHB + JPT and Yoruba in Ibadan,
Nigeria (YRI) were different of either each other or
of our population or of CEU. The third SNP was
rs75129444 which showed to be close in allele frequency
between Iranian and CEU populations.
Presently, due to restricted investigation on
human FABP9 we are unable to establish the
exact function of the protein and the related
mechanism in humans. FABP12, one of the
newly identified FABPs with expression in two
different tissues, testis and retina. It shows most
identity to FABP9 in phylogeny, structure and
expression pattern in testis in continuous sperm
developmental stages (13). Therefore, one can
further postulate that FABP9, like its counterpart,
may have human tissue expression, presumably
in different stage and/or different cell
type of testis. Examining regions of the geneintrons
1 and 2 would offer a complete genetic
analysis of this gene. The promoter region
would be associated with gene-expression levels
but, the complete promoter region for this
gene is not well characterized. Further research
will reveal any involvement of the gene in human
fertility.
Conclusion
This study showed no association between the
examined FABP9 exonic regions and sperm dysmorphology.
Jamshidi, J., Pouresmaeili, F., Darvish, H., Omrani, M. D., Azargashb, E., Sadeghi, M. R., & Lakpour, N. (2014). FABP9 Mutations Are Not Detected in Cases of Infertility due to Sperm Morphological Defects in Iranian Men. International Journal of Fertility and Sterility, 7(4), 275-280.
MLA
Javad Jamshidi; Farkhondeh Pouresmaeili; Hossein Darvish; Mir Davood Omrani; Eznollah Azargashb; Mohammad Reza Sadeghi; Niknam Lakpour. "FABP9 Mutations Are Not Detected in Cases of Infertility due to Sperm Morphological Defects in Iranian Men". International Journal of Fertility and Sterility, 7, 4, 2014, 275-280.
HARVARD
Jamshidi, J., Pouresmaeili, F., Darvish, H., Omrani, M. D., Azargashb, E., Sadeghi, M. R., Lakpour, N. (2014). 'FABP9 Mutations Are Not Detected in Cases of Infertility due to Sperm Morphological Defects in Iranian Men', International Journal of Fertility and Sterility, 7(4), pp. 275-280.
VANCOUVER
Jamshidi, J., Pouresmaeili, F., Darvish, H., Omrani, M. D., Azargashb, E., Sadeghi, M. R., Lakpour, N. FABP9 Mutations Are Not Detected in Cases of Infertility due to Sperm Morphological Defects in Iranian Men. International Journal of Fertility and Sterility, 2014; 7(4): 275-280.
)
