1
Department of Animal Science, College of Agriculture, Shiraz University, Shiraz, Iran
2
Histomorphometry and Stereology Research Center , Department of Anatomical Sciences, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
3
Biotechnology Institute, Shiraz University, Shiraz, Iran
4
4Department of Medical Biotechnology, School of Advanced Medical Sciences and Technologies, Shiraz University of Medical Sciences, Shiraz, Iran
5
5Stem Cell and Transgenic Technology Research Center and Department of Pharmacology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
6
6Department of Clinical Sciences, School of Veterinary Medicine, Shiraz University and Infertility Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
7
7Infertility Research Center & IVF Center, Shiraz University of Medical Sciences, Shiraz, Iran
Abstract
Kisspeptin and RFamide-related peptide-3 (RFRP-3) are known to affect GnRH/luteinizing hormone (LH) in several species, including the rat. It has been hypothesized that GnRH/LH changes during the rat estrous cycle may result from changes in the expression of KiSS1 and RFRP-3 genes. Therefore, the present study investigates KiSS1 and RFRP-3 gene expression at the transcriptional level in the rat hypothalamus during the estrous cycle. In the present experimental study, 36 adult female Sprague-Dawley rats (3-4 months old) were used to study the expression of KiSS1 and RFRP-3 mRNA in the hypothalamus during the estrous cycle. Four rats were ovariectomized, whereas the remainder were allotted to four different phases of the estrous cycle (n=8 per estrus phase). Rats were decapitated, and the hypothalami were immediately dissected and frozen in liquid nitrogen. Expressions of KiSS1 and RFRP-3 mRNAs were analyzed by real-time PCR. The expression of KiSS1 mRNA during estrus was lower than other phases of the cycle (p < 0.01). Expression of KiSS1 mRNA during the metestrus phase was lower than the proestrus phase (p < 0.01). The expression of RFRP-3 mRNA during proestrus was lower than the diestrus phase (p < 0.01). Results of the present study showed the role of coordinated expression of KiSS1 and RFRP-3 mRNA in the hypothalamus in the control of the rat estrous cycle.
Kisspeptins belong to a family of peptides encoded
by the KiSS1 gene and are natural ligands of
the GPR54 receptor. Kisspeptin has a fundamental
role in control of the gonadal axis (1, 2) . It has
been shown that kisspeptin neurons are located upstream
of GnRH neurons, and by affecting these
cells, stimulate luteinizing hormone (LH) release
(3). Because the excitatory effect of kisspeptin on
gonadotropin secretion is inhibited by GnRH antagonists
(4) and as kisspeptin administration to
hypothalamo-pituitary disconnected ewe models
could not change LH concentration (5), it has been concluded that kisspeptin acted at the hypothalamic
level, not the pituitary, to stimulate GnRH release.
Most GnRH neurons express GPR54 mRNA
(6) and many kisspeptin neurons in rats express
ERα (7). Thus it is possible that estrogen effects on
GnRH cells are mediated through these neurons.
The RFamide-related peptide-3 (RFRP-3) that
putatively modulates the negative feedback effect
of estrogen on gonadotropin secretion has
been identified in the brain of rodents. The RFRPir
cells, clustering in the dorsomedial nucleus of
the hypothalamus (DMH), have been identified in
hamsters, rats, and mice (8). Inhibitory effects of
RFRP-3 on gonadotropin release were reported in
rodents (9, 10) and sheep (11, 12).
The pattern of LH secretion during the estrous cycle
is a reflection of GnRH release. In the rat, serum
levels of LH are lowest in early estrus, shortly after
ovulation, and through metestrus, diestrus, and midproestrus.
On the afternoon of proestrus, the circulating
levels of LH begin to rise rapidly and peak
in the evening, resulting in ovulation. The blood
LH level then decreases and reaches basal levels by
the early morning of the estrus phase (13) . During
the estrus, metestrus, diestrus, and early proestrus,
the concentration of GnRH is at its basal level. At
mid-proestrus, the GnRH surge center is activated,
which increases the GnRH concentration (14). With
regards to the changing patterns of GnRH/LHs during
the estrous cycle and due to the excitatory effect
of kisspeptin and inhibition of RFRP-3 on GnRH/
LH, we have hypothesized that GnRH/LH changes
might result from changes in the expression of
KiSS1 and RFRP-3 genes. Simultaneous evaluation
of KiSS1 and RFRP-3 mRNA expressions in the rat
hypothalamus has not been studied. The aim of the
present study was to investigate KiSS1 and RFRP-3
gene expression at the transcriptional level in the
hypothalamus during the estrous cycle of the rat.
A total of 36 adult (3-4 months old) female
Sprague-Dawley rats (Rattus norvegicus) that
weighed 170-220 g were used in this study. The
rats were randomly selected and housed in the
Laboratory Animal Center of Shiraz University
of Medical Sciences, Shiraz, Iran under controlled
temperature (22°C) and light (12:12 light to
dark ratio; lights on at 7:30 AM) conditions. Rats
were treated humanely and in compliance with the
recommendations of the Animal Care Committee
of the Shiraz University of Medical Sciences. All
experimental procedures were carried out between
12.00-2.00 pm. Vaginal smears were prepared as
previously described (15) for identification of the
phases of the estrous cycles of the 32 intact rats.
We assigned 8 rats to each phase of the cycle.
The control group comprised 4 randomly selected
ovariectomized rats. The rats were anesthetized
by an intraperitoneal injection of ketamine
(100 mg/kg, Woerden, Netherlands) and xylazine
(7 mg/kg, Alfazyne, Woerden, Netherlands), then
ovariectomized through a ventral midline incision.
Further procedures were undertaken after a twoweek
recovery period.
The cyclic and ovariectomized rats were decapitated,
brains dissected out immediately, and the entire
hypothalami were dissected by the following
procedure: an anterior coronal section, approximately
1 mm anterior to the optic chiasma, and a
posterior coronal cut at the posterior border of the
mammillary bodies were made (16, 17). A small
portion of the thalamus located above the hypothalamus
was dissected out. There is no kisspeptin
expression in the thalamus (18). No other tissues
such as the subthalamus, epithalamus or any other
parts of the brain were dissected along with the hypothalamus,
because the posterior cut was located
at the posterior border of the mammillary bodies.
The sub-samples were frozen in liquid nitrogen
and stored at -80°C. For extraction of mRNA, at
least 100 mg of tissue was needed. We were unable
to extract mRNA from separate areas of the
hypothalamus. Thus, instead of using a single nucleolus
from the hypothalamus to evaluate relative
expression of RFRP-3/KiSS1 mRNA, all hypothalami
were used which was consistent with studies
of Navarro et al. (19) and Roa et al. (20).
Total RNA was extracted with RNX-Plus buffer
(Cinnagen, Iran). Briefly, approximately 100 mg
of the tissue were ground in liquid nitrogen. The
ground powder was transferred to 1 ml of RNXplus
buffer in an RNase-free microtube, mixed
thoroughly and maintained at room temperature
for 5 minutes. Chloroform (0.2 ml) was added
to the slurry and mixed gently. The mixture was
centrifuged at 15500 g at a temperature of 4°C for
15 minutes; the supernatant was transferred to another
tube and precipitated with an equal volume
of isopropanol for 15 minutes on ice. The RNA pellet was washed with 75% ethanol, quickly dried
and resuspended in 50 µl of RNase-free water. The
purified total RNA was quantified by a Nano-Drop
ND 1000 spectrophotometer (USA). The DNase
treatment was performed with a DNase kit (Fermentas,
Germany) according to the manufacturer’s
instructions. The DNase-treated RNA (3 µg) was
used for first strand cDNA synthesis, by using 100
pmol oligo-dT (18 mer), 15 pmol dNTPs, 20 U
RNase inhibitor and 200 U M-Mulv reverse transcriptase
(all from Fermentas, Germany) in a 20
µl final volume. We designed the primer with Allele
ID 7 software for the reference gene, KiSS1
(NM_181692) and RFRP-3 (NM_023952). The
rat glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) gene (M32599) was used as reference
gene for data normalization (Table 1).
Sequences of real-time PCR primers used to evaluate relative expression
of RFamide-related peptide-3 (RFRP-3) and KiSS1 genes in the rat
Primer
Sequence
Amplicon length (bp)
KiSS1-F
TGCTGCTTCTCCTCTGTG
116
KiSS1-R
CCAGGCATTAACGAGTTCC
RFRP-3-F
CTCAGCAGCCAACCTTCC
165
RFRP-3-R
AAACCAGCCAGTGTCTTG
GAPDH-F
AAGAAGGTGGTGAAGCAGGCATC
112
GAPDH-R
CGAAGGTGGAAGAGTGGGAGTTG
GAPDH;Glyceraldehyde-3-phosphate dehydrogenase.
A 30 µl volume of purified PCR product (for
KiSS1, RFRP-3 and GAPDH) was sent to Tech
Dragon Limited Company for sequencing. We
performed similarity search and sequence analysis
using the BLAST server of the NCBI gene bank.
Relative real-time PCR was performed in a 20 µl
volume that contained 1 µl cDNA, 1x Syber Green
buffer and 4 pmol of the primer. The amplification
reactions were carried out in a Line-Gene K
thermal cycler (Bioer, China) under the following
conditions: 2 minutes at 94°C, 40 cycles at 94°C
for 10 seconds, 57°C for 15 seconds and 72°C
for 30 seconds. After 40 cycles, the specificity
of the amplifications was tested by heating from
50°C to 95°C, which resulted in melting curves.
We repeated all amplification reactions three times
under identical conditions, including a negative
control and five standard samples. To ensure the
PCR products were generated from cDNA and
not genomic DNA, proper control reactions were
carried out in the absence of reverse transcriptase.
For quantitative real-time PCR data, we calculated
relative expression of KiSS1 and RFRP-3 based
on the threshold cycle (CT) method. CT for each
sample was calculated using Line-gene K software
(21). Fold expression of the target mRNAs over
reference values was calculated by the equation
2-ΔΔCT (22), where ΔCT is determined by subtracting
the corresponding GAPDH CT value (internal
control) from the specific CT of the target (KiSS1
or RFRP-3). ΔΔCT was obtained by subtracting the
ΔCT of each experimental sample from that of the
calibrator sample (ovariectomized rats).
Data on the relative expression of KiSS1 and
RFRP-3 genes, and the ratio of RFRP-3/KiSS1
were subjected to the test of normality. Analysis of
variance for both variables were performed using
Proc GLM (SAS, 2002) followed by mean comparison
by Duncan`s multiple range test. We considered
p<0.01 as significant. Group means and
their standard error have been reported in the text.
Expression of KiSS1 mRNA in the hypothalamus
of female rats at different phases of the estrous cycle
is shown in figure 1.
Mean (± standard error) of the relative expression of
KiSS1 gene in the hypothalamus of rats (n=8) during the
estrous cycle. Different letters indicate significant difference
(p<0.01).
There was lower expression of KiSS1 mRNA
during the estrus phase (28.61 ± 3.48) compared to the other phases of the cycle (p<0.01). Expression
of KiSS1 mRNA during metestrus (62.78 ±
7.98) was lower than proestrus (94.62 ± 10.57,
p<0.01). The expression of KiSS1 mRNA during
the diestrus phase did not significantly differ from
the metestrus and proestrus phases.
Expression of RFRP-3 mRNA during proestrus
(49.06 ± 7.92) was lower than the diestrus phase
(126.41±17.89, p<0.01, Fig 2).
Mean (± standard error) of the relative expression of
RFamide-related peptide-3 (RFRP-3) gene in the hypothalamus
of rats (n=8) during the estrous cycle. Different letters
indicate significant difference (p<0.01).
Intermediate values were found during the estrus
(94.07 ± 11.43) and metestrus (85.96 ± 13.04)
phases, which did not significantly differ from the
observed values during the proestrus and diestrus
phases. The expression ratio of RFRP-3 and KiSS1
mRNA in the proestrus and estrus phases were obviously
contrariwise. There was a higher expression
ratio of RFRP-3:KiSS1 mRNA during the estrus
(3.85 ± 0.75) phase compared to the other phases of
the estrous cycle (p<0.05, Fig 3).
Mean (± standard error) of the relative expression of
RFamide-related peptide-3 (RFRP-3) gene in the hypothalamus
of rats (n=8) during the estrous cycle. Different letters
indicate significant difference (p<0.01).
This ratio in the diestrus (2.04 ± 0.42) phase was
more than proestrus (0.59 ± 0.13, p<0.05). The
expression ratio of RFRP-3:KiSS1 mRNA during
estrus (1.51 ± 0.25) did not significantly differ
with the diestrus and proestrus phases. The ratio of
RFRP-3:KiSS1 expressions were: proestrus (1:2),
estrus (4:1) and diestrus (2:1).
The lowest expression of KiSS1 mRNA in the
hypothalamus was observed during the estrus
phase. Studies using immunohistochemistry and in
situ hybridization showed that kisspeptin peptide
and KiSS1 mRNA were concentrated in the arcuate
nucleus (ARC) and anteroventral periventricular
nucleus (AVPV) of rodents (23, 24). A small
population of kisspeptin neurons were also identified
in the preoptic periventricular nucleus (PeN)
(23). Ovariectomy led to a significant increase in
KiSS1 mRNA in the entire hypothalamus of rats
while this increase in gene expression was not observed
in estradiol-implanted ovariectomized animals
(19). Another study, using in situ hybridization,
reported an increase in KiSS1 mRNA of the
mouse hypothalamus as a result of increases in
KiSS1 mRNA expression in kisspeptin neurons in
the ARC. It was suggested that kisspeptin neurons
of the ARC probably mediated the negative feedback
effect of estrogen on gonadotropin secretion,
which might be the GnRH pulse generating center.
In contrast to ARC, there was reduced KiSS1
mRNA expression in AVPV and PeN after ovariectomy,
which increased after estradiol implantation.
It was hypothesized that AVPV might have a role
in preovulatory GnRH/LH surge (25). Another
study reported that although kisspeptin neuronal
activity in AVPV increased with estrogen treatment
and could have a role in the preovulatory surge,
kisspeptin neuronal activity in ARC was inhibited
by estrogen which could act as a site for the negative
feedback of steroids on GnRH and LH secretion
(7). Investigation of KiSS1 mRNA expression
in ARC and AVPV at different phases of the estrous
cycle in rats has shown the highest KiSS1 mRNA
levels in AVPV during proestrus and lowest during
metestrus. This is consistent with the hypothesis
that kisspeptin neurons in AVPV are regulated by
the estrogen positive feedback. The level of KiSS1
mRNA in ARC has been shown to be highest during
diestrus and lowest during proestrus. It seems
that during the estrous cycle, kisspeptin expression
in ARC gradually increases from proestrus to the diestrus phase (26).
Results of the present study showed that KiSS1
mRNA expression in the hypothalamus was higher
during proestrus than estrus. Consistent with
these findings, Adachi et al. (26) have determined
that gene expression during proestrus is highest in
AVPV and lowest in ARC. The KiSS1 mRNA expression
in ARC is negatively regulated by estrogen
(27). The lowest level of KiSS1 mRNA expression
has been recorded during estrus, which agreed with
the low level of gene expression in these nuclei at
this stage of the cycle. High levels of KiSS1 mRNA
were also recorded during metestrus and diestrus, a
finding consistent with the high level of ARC gene
expression during the cycle (26).
The relative expression of RFRP-3 mRNA was
higher during diestrus compared with the proestrus
phase. Consistent with these results, the number of
RFRP-expressing neurons and the percentage of
FOS-expressing RFRP neurons in hamsters were
higher during diestrus than in the evening of proestrus.
RFRP-3 peptide cells only exist in the DMH of
rodents (8). RFRP-3 has an inhibitory effect on the
GnRH neuronal system in rats (28) and mice (29).
Approximately 40% of RFRP neurons in the DMH
of hamsters (8) and about 18% of these neurons in
ovariectomized mice (29) express ERα and the axon
terminals of these neurons project to the GnRH neurons
in mice, rats and hamsters (8). RFRP-3 cause
hyperpolarization (30) and decrease the electrical
activity of GnRH neurons (31); administration of
17β-estradiol significantly reduced prepro-RFRP
mRNA expression in ovariectomized mice (29).
In rats, ovarian estradiol secretion during the
estrus phase is low, while at the end of metestrus
estrogen secretion begins to increase and is high
during the diestrus phase; it peaks in the proestrus
evening, thereafter declining to its basal level (13).
As administration of RFRP-3 inhibits GnRH neuronal
activity during an estrogen-induced LH surge
(32) it seems that RFRP-3 influence is absent at
this period. Maximal estradiol concentration in
the estrous cycle of rats occurs during proestrus,
whereas minimal levels are seen during estrus.
Therefore, in support of our findings, it seems
that the high estradiol concentration secreted in
the evening of the proestrus phase from dominant
ovarian follicles stimulates kisspeptin neurons of
the AVPV and inhibits RFRP neurons in DMH.
A decrease in the RFRP-3:KiSS1 ratio guarantees
the possibility of surge occurrence. Therefore,
a high concentration of estradiol during the proestrus
phase leads into GnRH/LH surge and ovulation.
On the other hand, estradiol secretion in the
estrus phase is at basal level. Therefore, removing
its inhibitory effect on RFRP neurons increases
the RFRP-3:KiSS1 ratio. Medium concentrations
of this steroid are secreted in the afternoon of diestrus
(13). Therefore, it is probable that increase
in RFRP expression along with secretion of progesterone
from the corpus luteum inhibits the
GnRH/LH surge and subsequent ovulation during
diestrus.
The ratio of RFRP-3:KiSS-1 expression at proestrus,
estrus and diestrus was 1:2, 4:1, and 2:1,
respectively. Results of the present study showed
the role of coordinated expression of KiSS1 and
RFRP-3 mRNA in the hypothalamus in the control
of the rat estrous cycle.
Salehi, M., Jafarzadeh Shirazi, M., Zamiri, M., Pazhoohi, F., Namavar, M., Niazi, A., Ramezani, A., Tanideh, N., Tamadon, A., Zarei, A. (2013). Hypothalamic Expression of KiSS1 and RFamide-related Peptide-3 mRNAs during The Estrous Cycle of Rats. International Journal of Fertility and Sterility, 6(4), 304-309.
MLA
Mohammad Saied Salehi; Mohammad Reza Jafarzadeh Shirazi; Mohammad Javad Zamiri; Farid Pazhoohi; Mohammad Reza Namavar; Ali Niazi; Amin Ramezani; Nader Tanideh; Amin Tamadon; Afsoon Zarei. "Hypothalamic Expression of KiSS1 and RFamide-related Peptide-3 mRNAs during The Estrous Cycle of Rats". International Journal of Fertility and Sterility, 6, 4, 2013, 304-309.
HARVARD
Salehi, M., Jafarzadeh Shirazi, M., Zamiri, M., Pazhoohi, F., Namavar, M., Niazi, A., Ramezani, A., Tanideh, N., Tamadon, A., Zarei, A. (2013). 'Hypothalamic Expression of KiSS1 and RFamide-related Peptide-3 mRNAs during The Estrous Cycle of Rats', International Journal of Fertility and Sterility, 6(4), pp. 304-309.
VANCOUVER
Salehi, M., Jafarzadeh Shirazi, M., Zamiri, M., Pazhoohi, F., Namavar, M., Niazi, A., Ramezani, A., Tanideh, N., Tamadon, A., Zarei, A. Hypothalamic Expression of KiSS1 and RFamide-related Peptide-3 mRNAs during The Estrous Cycle of Rats. International Journal of Fertility and Sterility, 2013; 6(4): 304-309.