Document Type : Original Article
Authors
1 Department of Basic Sciences, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
2 Department of Comparative Histology and Embryology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran
Abstract
Keywords
Recently, food consumers are increasingly concerned
about the quality and safety of many foodstuffs produced
by industrialized countries; in particular, the usage of
artificial sweeteners, flavorings, dyes, preservatives and
food supplements has raised concerns. Many non-nutrient
sweeteners have been used in foods and beverages to help
people enjoy a sweet taste without raising body calories.
One of these sweeteners is aspartame (
After oral intake, aspartame is hydrolyzed in the gastrointestinal
tract by esterases and peptidases into amino acids
(aspartic acid and phenylalanine) and methanol. Also, it is
possible that aspartame is absorbed by the mucosal cells of
the intestines and metabolized before hydrolysis (
Methanol is not metabolized in the enterocytes; it immediately
enters the portal circulation and is then oxidized
in the liver into formaldehyde (
Considering the fact that the majority of these chaperone
families are cell stress responders or heat shock proteins
(HSPs), chaperones have important roles in raising
the cellular resistance against environmental stressors,
although the HSPs are known to be involved in regulating
spermatogenesis (
Aspartame was purchased from Sigma-Aldrich (St Louis, MO, USA, CAS No. 22839-47-0).
Acridine orange was purchased from sigma chemical Co. (St. Louis, MO, USA). All other
chemicals used were commercial products of analytical grade. The rabbit anti-mouse primary
antibodies for
All experimental protocols were conducted on the basis of the proofed principles for laboratory animal care (7506025.6.24), approved by the Ethical Committee of the University of Tehran. For this study, a total number of 36 NMRI mature male mice (8-10 weeks of age), weighing 25-35 g were used. The animals were provided from the Laboratory Animal Sciences Center, Pasteur Institute of Iran, Karaj, Iran. Before initiation of the treatment period, the mice were maintained for two weeks in order to acclimatize. The mice were housed in special cages under well-ventilated conditions at normal temperature (22 ± 5°C) with 12:12-hour light-dark cycles and fed standard pellet diet (Tehran pellet, Iran).
In this experimental study, The European Food Safety Authority has confirmed acceptable daily intake (ADI) for 40 mg/kg bodyweight/day of aspartame. This ADI was approved by the food and drug administration (FDA) for the European countries (EFSA Journal 2013). After labeling the mice, they were randomly divided into four groups of nine mice. The treatment groups received aspartame for 90 days by gavage as follows:
1. The first group (control): The animals of this group received normal saline at the dosage of 0.5 ml.
2. The second group was called low dose aspartame and it received 40 mg/kg bodyweight/day of aspartame.
3. The third group was called medium dose aspartame and it received 80 mg/kg bodyweight/day of aspartame.
4. The forth group was called high dose aspartame and it received 160 mg/kg bodyweight/day of aspartame.
Thereafter, the animals were kept under standard conditions
and monitored for 90 days. On the basis of the fact
that the duration of the chronic dose of aspartame is ninety
days to have probable pathogenicity, this period was
chosen for this experiment. The dosages and duration of
the treatment in the present study were chosen on the basis
of earlier studies (
Following the 90-day period, all animals were anesthetized
using a mixture of ketamine and xylazine cocktail (0.10
ml xylazine and 1 ml ketamine and 8.90 ml distilled water),
with the dose of 0.1 ml/10 g BW (
The testes were quickly dissected out, cleared of adhered
connective tissue and weighed on a digital scale (with a
minimum accuracy of 0.001 g). For Histomorphometrical
study, Dino-Lite digital lens and Dino Capture 2 Software
were used. Furthermore, histometrical structures of the
testes, including testicular capsule thickness, germinal epithelium height and diameter of seminiferous tubules,
as well as the number of Sertoli and Leydig cells were
evaluated. In order to classify spermatogenesis, Johnsen’s
criteria were used. This classification is based on graded
scoring between 1-10 for each tubule cross-section, according
to presence or absence of main cell types organized
in the order of maturity:10, complete spermatogenesis
exists and tubules are normal in arrangement; 9, there
are many spermatozoa with disorganization in germinal
epithelium; 8, only a few spermatozoa are observed; 7,
lacking spermatozoa while many spermatids exist; 6, only
a few spermatids are present; 5, absence of spermatozoa
and spermatids but existence of many spermatocytes; 4,
only a few spermatocytes exist; 3, only spermatogonia are
observed; 2, presence of only Sertoli cells and the absence
of germ cells, and 1, no germ cells or Sertoli cells are present.
Tubule cross-sections with scores of 9 and 10 were
considered mature tubules (
Paraffin blocks were sectioned at 5-6 μm and stained with Hematoxylin and Eosin (H&E), Periodic acid-Schiff (PAS) and Masson's trichrome. Masson’s trichrome staining was used to show the amount of collagen fibers and fibrosis in testicular tissue. In order to analyze carbohydrate ratio in testicular germinal epithelium, PAS was conducted on specimens. Also, for the purpose of histochemical evaluations, frozen sectioning method was carried out. The samples were embedded using optimal cutting temperature compound (OCT gel) and sections of testicular tissues were prepared at 15-20 μm levels at -40°C using cryostat (SLEE, Germany). Also, the Sudan black B (SB) staining was performed to evaluate the rate of lipid foci supplement in treatment and control animals and identify the Leydig cells cytoplasmic bio-steroid supplement. The alkaline phosphatase staining (ALP) was conducted to demonstrate the ratio of this enzyme as a biomarker for inflammation. The photomicrographs were taken by a SONY on-board camera (Zeiss, Cyber-Shot, Japan).
Epididymides were carefully refined from their surrounding tissues under 10X
magnification provided by a Stereo Zoom Microscope (TL2, Olympus Co., Tokyo). The caudate
part of the epididymis was trimmed and minced in 5 ml TCM199 medium for 30 minutes, with
5% CO2, at 36.5°C in a CO2- equipped incubator (LEEC Co., England).
After centrifugation, the sperm pellet was re-suspended in 0.5 ml of TCM199 medium. A
small aliquot (20 μl) of sperm suspension was glass-smeared. The slides were air-dried and
then fixed overnight in Carnoy’s solution (methanol/acetic acid, 3:1). Next, they were
stained for 5 minutes with a freshly-prepared acridine orange stain (AO). After washing
and drying, the slides were examined using a fluorescent microscope (Leitz, Germany;
excitation of 450-490 nm). On each slide, an average of 200 sperms were evaluated and two
types of staining patterns were identified including yellow (single-stranded DNA) sperms
and green (double-stranded DNA) (
The percentage of spermatozoa with single-stranded DNA was calculated from the ratio of spermatozoa with red, orange, or yellow fluorescence, to the total spermatozoa counted per sample.
Sperm count was assessed by a standard hemocytometer method (
The Eosin-nigrosin staining method was performed
to assess the sperm viability. For this purpose, 50 μl of
sperm was mixed with 20 μl of eosin in a sterile test tube.
After 5 seconds, 50 μl of nigrosin was added and mixed
thoroughly. Then, the mixture of the stained sperm was
smeared on the slide and examined under a light microscope
(1,000X magnification, Olympus, Germany). The
colorless sperms were considered live and the yellow to
pink stained sperms were marked as dead. The sperm
count was performed according to the standard hemocytometric
method previously described by Pant and Srivastava
(
Following 90 days, blood samples were obtained directly from the heart under light anesthesia (induced using diethyl ether). After 15 minutes, the samples were centrifuged at 3000×g for 10 minutes at RT to obtain serum. Serum concentration of testosterone was measured by enzyme-linked immunosorbent assay (ELISA) as described by the manufacturer (Demeditec Diagnostics GmbH, Germany). In brief, 100 μl of serum sample and control (from the kit) were dispensed into the ELISA wells, and 100 μl of Enzyme conjugate was added into the wells and thereafter, incubated 60 minutes at RT. Next, the content of the wells was discarded and rinsed 4 times with diluted Wash Solution (300 μl per well), and 200 μl of Substrate Solution was added to each ELISA well. The samples were thereafter incubated in the dark for 30 minutes. Finally, 50 μl of Stop Solution was added to each well and the absorbance of each sample was determined at 450 nm.
Some important detectable oxidative stress biomarkers,
including total antioxidant capacity (TAC), and activities of
antioxidant enzymes catalase (CAT), superoxide dismutase
(SOD), glutathione peroxidase (GSH-Px), and malondialdehyde
(MDA) and nitric oxide (NO) content were measured
in the blood samples as described previously (
Determination of GSH-Px activity was performed by GSH-Px detection kit (Ransel, RanDox Co, UK) based on manufacturer’s instructions. One unit of GSH-Px was defined as μM of oxidized NADPH per minute mg-1 of protein. A decrease in absorbance was recorded by spectrophotometry against blank, at 340 nm.
The SOD activity was evaluated at 505 nm using a standard curve. The SOD activity was
determined by the SOD detection kit (RanSod, RanDox Co, UK) based on the manufacturer’s
instructions. Serum NO level was measured according to the Griess reaction (
The MDA level as an indicator of lipid peroxidation in serum was determined according to
the procedure described by Buege and Aust. Here, 100 μl of serum specimens using a glass
homogenizer was homogenized in 0.15 M/l KCl at a ratio of 1 to 9 ml. One volume of
homogenate was blended thoroughly with two volumes of a stock solution of 15% w/v
trichloroacetic acid, 0.375% w/v thiobarbituric acid, and 0.25 M/l hydrochloric acid.
After heating and cooling cycles, the solution was clarified by centrifugation at 1000 ×g
for 10 minutes. The absorbance of the clear solution was read at 535 nm and MDA content
was figured out using 1.56 ×105 M-1 cm-1 as molar absorbance coefficient. MDA
levels are presented as mM per ml protein (
Evaluation of TAC was carried out on the basis of the manual of the kit (TAS test kit, Randox Laboratories Ltd, GB).
Immunohistochemical staining was done in order to analyze Hsp70-2 positive cells
distribution. For this, before beginning the staining process, 5-μm tissue sections were
heated at 60°C for approximately 25 minutes in a hot-air oven (Venticell, MMM,
Einrichtungen, Germany). After deparaffinization in two changes of xylene, the sections
were rehydrated using an alcohol gradient (96, 90, 80, 70, and 50%). The antigen retrieval
process was performed in 10 mM sodium citrate buffer (pH=7.2). Immunohistochemical
staining was conducted according to the manufacturer’s protocol (Biocare, USA). In brief,
endogenous peroxidase was blocked in a peroxidase blocking solution (0.03% hydrogen
peroxide containing sodium azide) for 5 minutes. Washing the sections was done with
phosphate-buffered saline (PBS, DNAbiotech, Iran, pH=7) and subsequently incubation was
performed with Hsp70-2 (1:600) biotinylated primary antibodies (Biocare, USA) at 4°C in
humidified chamber overnight. After rinsing with PBS, the sections were incubated with
streptavidin–HRP (streptavidin conjugated to horseradish PBS containing an anti-microbial
agent) for 20 minutes. Followed by rinsing in washing buffer and adding a 3,3'
Diaminobenzidine (DAB) chromogen, they were incubated for 10 minutes and counter stained
with hematoxylin for 10 seconds. Then, the sections were dipped in ammonia (0.037 Ml),
rinsed with distilled water, and cover slipped. Positive immunohistochemical staining
could be observed as brown stains under a light microscope (
For RNA extraction, the collected testicles and those previously stored at -70°C, were
used; RNA extraction was performed on the basis of the standard TRIzol method (
Nucleotide sequences and product size of primers used in reverse transcription-polymerase chain reaction
Target gene | Primer sequence (5'-3') | Product size (bp) |
---|---|---|
F: CAGCGAGGCTGACAAGAAGAA | 340 | |
R: GGAGATGACCTCCTGGCACT | ||
F: TGAAGCAGGCATCTGAGGG | 320 | |
R: CGAAGGTGGAAGAGTGGGAG | ||
The data was analyzed using SPSS program version 19.0 (SPSS Inc, Chicago, IL, USA). All results are presented as mean ± SD. Differences between quantitative histological and biochemical data were analyzed by oneway ANOVA, followed by Tukey test, using Graph Pad Prism, 4.00. The P<0.05 were considered statistically significant.
The results of histomorphometric studies showed that
the thickness of testicular capsule in the high-dose group
of aspartame, had a significant increase compared to the
control group, whereas, the number of Sertoli and Leydig
cells showed a significant decrease (P<0.05) in this
group. Also, in medium- and high-dose aspartame-treated
groups, a significant decrease (P<0.05) was observed in
the diameter of the seminiferous tubules, the height of the
germinal epithelium and the Johnsen’s score (
Our histological observations revealed that aspartame,
in a dose-dependent manner, could increase disarrangement and produce severe edema in connective tissue. An
increase in germinal epithelium dissociation (GED) and
tubular depletion in medium- and high-dose aspartametreated
groups, was observed. Especially in the highdose
group, aspartame could induce drastic morphologic
changes in the testes. There were some atrophied seminiferous
tubules indicating severe reduction in the number of
germ cells and intensive immune cells infiltration, edematous
fluid accumulation and intertubular space widening
in interstitial connective tissue. Moreover, Sertoli cells
lost their junction with germ cells and looked amorphous
with irregular and smaller nuclei (
Also, concerning the histochemical features observed following
Masson’s trichrome staining, it was found that the
groups do not differ in the density of collagen fibers. Histochemical
analyses of the PAS-stained specimens elucidated
that the cells in three first layers of spermatogenesis cell series,
Sertoli and Leydig cells faintly reacted with PAS in medium-
and high-dose aspartame-treated groups and the carbohydrate
ratio was severely decreased in their cytoplasm.
In Sudan black B staining, in seminiferous tubules, brown to
black particles which contain lipid were clearly seen inside
the cytoplasm of the cells close to the lumina of seminiferous
tubules and Leydig cells. No cytoplasmic lipids in Leydig
cells and spermatogenesis series cells in the control group,
were observed. Animals in the aspartame receiving groups
showed high lipid-stained sites in the cytoplasm of the Leydig
cells and spermatogenesis series cells. In testicular tissue
section, alkaline phosphates staining indicated the highest
rate of small brown particles in the cytoplasm of Leydig cells
and spermatogenesis cells in the high-dose group, compared
to the other groups. In addition, it should be noted that the
level of alkaline phosphatase reaction in the groups treated
with aspartame was dose-dependently increased (
Comparison of sperm parameters (± SD) between the experimental groups after frozen-thawed and treatment with 10 μg/ml Calligonum (CGM) extract and LIPUS (pulsed mode and continues wave)
Parameters | Control | Low dose | Medium dose | High dose |
---|---|---|---|---|
TBW (g) | 36.12 ± 2.82a | 36.31 ± 3.06a | 36.38 ± 3.67a | 37.31 ± 3.01a |
TW (g) | 0.12 ± 0.011a | 0.12 ± 0.009a | 0.12 ± 0.008a | 0.10 ± 0.010b |
BWA (g) | 4.62 ± 0.67a | 5.24 ± 1.56ab | 5.58 ± 2.53ab | 6.97 ± 1.15b |
Testosterone (ng/ml) | 6.88 ± 0.32a | 6.44 ± 0.30a | 6.22 ± 0.53a | 5.10 ± 0.57b |
STsD (μm) | 194.38 ± 4.33a | 187.48 ± 5.56a | 173.32 ± 5.78b | 161.96 ± 5.45c |
GEH (μm) | 58.97 ± 3.48a | 57.36 ± 2.36a | 50.02 ± 1.79b | 43.69 ± 3.28c |
TCT (μm) | 13.47 ± 1.27a | 14.07 ± 2.09a | 16.41 ± 1.93a | 20.70 ± 2.58b |
LCs (No/mm2) | 37.35 ± 2.79a | 36.82 ± 2.11a | 33.57 ± 2.30a | 28.72 ± 2.97b |
SCs (No/one tubule) | 22.76 ± 1.37a | 22.79 ± 1.64a | 20.72 ± 1.83a | 16.68 ± 1.55b |
Johnsen’s score | 9.42 ± 0.26a | 9.35 ± 0.30a | 8.64 ± 0.39b | 7.52 ± 0.47c |
Sperm count (×106) | 34.66 ± 1.65a | 31.55 ± 1.42b | 27.44 ± 1.81c | 19.22 ± 1.48b |
Sperm motility (%) | 85.06 ± 2.32a | 81.95 ± 3.32a | 74.34 ± 1.25b | 62.40 ± 2.98c |
Sperm viability (%) | 89.22 ± 1.56a | 86.66 ± 2.73a | 79.33 ± 1.80b | 72.55 ± 2.12c |
DNA damage sperms (%) | 5.11 ± 1.36a | 7.55 ± 1.94a | 11.22 ± 2.16b | 19.33 ± 2.12c |
Abnormal sperms (%) | 10.33 ± 0.86a | 11.66 ± 1.22a | 15.44 ± 1.87b | 19.88 ± 1.69c |
All data are presented as mean ± SD. Low dose; 40 mg/kg aspartame-treated, Medium dose; 80 mg/kg aspartame-treated, High dose; 160 mg/kg aspartame-treated. TBW; Total body weight, TW; Testicular weight, BWA; Body weight alternations, STsD; Seminiferous tubules diameter, GEH; Germinal epithelium height, TCT; Testicular capsule thickness, LCs; Leydig cells, and SCs; Sertoli cells. Different superscripts in the same row show significant differences between groups (P<0.05).
Cross sections from testes: Hematoxylin & Eosin staining; intact spermatogenesis is seen in the control group. Cross sections from medium- and high-dose groups present reduced epithelial height as well as germinal epithelium dissociation (GED), edema (E) and oedematous fluid accumulation (EF) of interstitial connective tissue, immune cells infiltration (IMN.I), atrophic and depletion seminiferous tubules (TD), giant cell (GC), detachment of Sertoli cell (SC) and spermatogenesis. Masson’s trichrome staining; there was no difference in the amount of collagen fibers between the control group and the aspartame-treated groups. Periodic acid-Schiff staining; Control group with the Leydig cells (arrows), Sertoli cells (head arrows) and the first three cell layers (lines) with normal Periodic acid-Schiff (PAS) reaction. Low-dose group with light germinal cell dissociation and moderated PAS reaction are present in seminiferous tubules. Medium- and high-dose groups with negative PAS reaction in Leydig cells (arrows), Sertoli cells (head arrows) and the first three cell layers (lines) with faint PAS-stained cytoplasm. Sudan black B staining; Frozen sections from testes. Control group with spermatogenesis series cell lineage with negative Sudan black B-stained cytoplasms (arrows) and Leydig cells area (head arrows) are appeared with dense reaction sites. Comparing aspartame-treated groups with the control group indicates that in low-dose group, spermatogenesis series cells are presented with faint lipid stained cytoplasms (arrows) and Leydig cells area (head arrows) stained densely, while the medium- and high-dose groups are manifested with darkly stained spermatogenesis series cells (arrows) and Leydig cells area (head arrows). Alkaline phosphates staining; Frozen sections from testes. All germinal epithelium cells (head arrows) and Leydig cells area (arrows) in the control group are presented with the negative alkaline phosphatase (ALP) reaction. Comparing the aspartame-received groups reveals that there are numbers of cells in the germinal epithelium (head arrows) and Leydig cells (arrows) with ALP-stained cytoplasms (scale bar: 60 μm).
Observations showed that aspartame in a dose-dependent
manner, significantly (P<0.05) reduced the
sperm count. Survival rate and sperm motility in medium-
and high-doses aspartame-treated groups were
significantly decreased (P<0.05) compared to the control
group. Also, the average percentage of abnormal
sperms as well as the percentage of sperms with damaged
DNA, in medium- and high-dose aspartame-treated
groups was significantly increased (P<0.05,
Photomicrographs of mice epididymal spermatozoa.
Aspartame effects on various parameters of oxidative stress biomarkers in serum and blood samples are shown in Figure 3. As can be seen, aspartame administration resulted in a significant increase (P<0.05) in MDA levels in the high-dose group as well as NO in medium- and high-dose aspartame-treated groups compared to the control group. Also, our observations showed that aspartame could induce a significant decrease (P<0.05) in TAC and CAT activity in the highdose group and consequently led to a significant decrease (P<0.05) in the level of GSH-Px and SOD in both medium- and high-dose aspartame-treated groups compared to the control group.
Effect of aspartame on antioxidant status.
The mRNA and protein levels of Hsp70-2 were analyzed.
In order to clarify Hsp70-2 expression in different
cellular layers of germinal epithelium, immunohistochemical
analyses were done. Our finding revealed
that, biosynthesis of Hsp70-2 increased in low-dose
aspartame-treated group (especially at spermatocytes
and spermatids cell lineages) versus the control group.
However, it was significantly decreased in medium- and
high-dose aspartame-treated groups. The immunohistochemical
results were confirmed by the semiquantitative
RT-PCR analysis. A significant (P<0.05) increase in the
mRNA level of Hsp70-2 was observed in the animals
treated with low-dose aspartame. However, the mRNA
levels of Hsp70-2 decreased in medium- and high-dose
aspartame-treated groups (
Effect of aspartame on Hsp70-2 protein expression in different groups.
Aspartame which is extensively used in food and medicinal
products as a low-calorie sweetener, is mostly
consumed by people trying to lose weights, patients with
diabetes, and athletes (
It was determined that aspartame has an effect on
weight loss in humans and it can reduce weight and control
obesity (
Evidence indicates that oxidative stress can cause
sperm abnormalities through various mechanisms such
as inducing lipid peroxidation in sperm plasma membrane,
sperm motility disorder, sperm abnormal morphology
and fracture in sperm DNA (
The mechanism of action of aspartame may also be
mediated via its effect on Leydig cells, which leads to
a decrease in testosterone levels. With degradation and
atrophy of Leydig cells under the influence of formaldehyde
produced from aspartame, the levels of synthesis
and secretion of testosterone decrease (
Besides, in order to achieve insight into the delicate
in vivo oxidants/antioxidants balance, measurement of
TAC could be proper. High polyunsaturated acid ratio
in testes and sperm causes the male reproductive system
to be susceptible to oxidative stress. The collaboration
of antioxidant enzymes, SOD, CAT and GSH-Px,
in cleansing ROS causes a protection of tissues and
cells from oxidants’ harmful effects. So, even minor
changes in normal contents of the mentioned enzymes
could result in susceptibility of biomolecules to oxidative
damages and so disturbances in the defense shield
of the body (
Under different stress conditions, Hsp70-2 plays an important role in homeostasis although
under physiological conditions, it is usually involved in assembling intracytoplasmic
proteins. Also, biosynthesis of Hsp70-2 protein could be directly changed depending on the
free radicals generation ratio in testicular tissue and depending on androgen withdrawal, it
might be altered indirectly. In our study, immunohistochemical and semi-quantitative RT-PCR
assessment indicated that in low-dose aspartame-exposed animals, the expression of
While Hsps are considered regulators of apoptosis, because
of this fact that the oxygen radical induced synthesis
of stress proteins could result in oxidative stress
tolerance, it seems that Hsp plays a role in protecting
of the oxyradical-induced changes (
In several studies, assessment of histomorphometric
parameters of testicular tissue is considered an appropriate
approach for evaluating the extent of damage to this
organ (
The alkaline phosphatase enzyme plays an important
role in cellular processes. Cell membrane damage results
in the release of this enzyme in the cell and ultimately, in
the serum. Thus, alkaline phosphatase enzyme measurement
is used as an indicator for testicular tissue changes
(
The findings of this study suggest that aspartame due to increased production of free radicals, induction of oxidative stresses and weakening the antioxidant defense system, could induce some disorders related to histomorphometric and serum parameters, increasing oxidative and nitrosative stress and down-regulating chaperone Hsp70-2 expression/biosynthesis, sperm quality and histochemical changes in medium- and highdose groups of mice. However, the results of the lowdose aspartame did not significantly differ from the control group's results and did not show any damages observed in the two other groups. Nonetheless, confirmation of the toxicity of aspartame in male reproductive system requires more extensive experimental studies, as well as clinical trials.