Document Type : Original Article
Authors
Department of Biology, Faculty of Sciences, Central Tehran Branch, Islamic Azad University, Tehran, Iran
Abstract
Keywords
Pre-eclampsia (PE) is one of the most common types
of abnormality in pregnancy associating with increased
blood pressure in the second half of pregnancy and proteinuria (protein excretion in the urine) and is considered
as one of the three main causes of maternal and fetal mortality and related complications (
Expulsion of the fetus and placenta from the mother’s
body eliminates symptoms of the disease, but complications of the disease can be problematic for the child and
mother until the end of life (
There are two types of PE: mild and severe. Mild form
of PE is diagnosed when pregnancy is greater than 20
weeks, blood pressure is greater than 140 systolic or 90
diastolic, 0.3 g of protein is collected in a 24-hours urine
sample or persistent 1+ protein measurement on urine
dipstick. There is no other sign of problem in the mother
or baby (
Many studies have pointed the importance of vascular
endothelial growth factor (VEGF) gene in the pathogenesis of PE (
Today, a large number of women are suffering from
PE during pregnancy. Unfortunately, the main causes of
this disease have not yet been known. It seems that the
mutation in the VEGF gene is one of the main causes of
this disease (
This study was approves by Ethics committee of Islamic Azad University- Science and research branch (Tehran, Iran, approval number: IR.I-AU.SRB. REC.1397.111).
This is a case-control study in which three SNPs of
Exclusion criteria included history of any cardiovascular disease, metabolic disease, hypertension before pregnancy, smoking of cigarette, chronic hypertension and
kidney disease before or during this research (
The primers and size of the amplified sequences
Gene | Primer sequences (5ˊ-3ˊ) | PCRproduct size |
---|---|---|
F: TGGTGAAGTTCATGGATGTCTATC | 115 | |
R: ACACAGGATGGCTTGAAGATG | ||
F: GTGCTAATGTTATTGGTGTCTTC | 508 | |
R: CAATGTGTCTCTTCTCTTCGC | ||
PCR; Polymerase chain reaction
Polymerase chain reaction (PCR) reaction was performed in 25 μl volume, containing 100-300 ng of extracted DNA, 1X PCR buffer (included 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl2), 2 mM MgCl2, 200 µM dNTP mix and double distilled water, 1 U of Taq DNA polymerase (super Taq DNA polymerase, Gen Fanavaran Co., Iran) and 0.4 µM of each oligoneucleotide primer in Thermocycler (Epperndorf-Nexus, Germany). PCR program was performed as follow: enzyme activation at 95ºC for 5 minutes, denaturation at 95ºC for 30 seconds, annealing at 58ºC for 30 seconds, elongation at 72ºC for 30 seconds for 30 cycles and a final extension at 72ºC for 5 minutes. PCR products were loaded on 1% agarose gel followed by ethidium bromide staining to confirm specificity and quality of the amplified fragments (PCR kit, Gen Fanavaran Co. DATA sheet).
To determine genotype of the PCR products, the samples were sequenced. They were next analyzed by FinchTV software and the accuracy of work was ultimately confirmed.
SPSS software (BMI SPSS statistics version 22, USA) was used for data analysis and only 5% was considered as acceptable rate of the type 1 error. The SHEsis software was used to examine the Hardy-Weinberg equilibrium and to evaluate the extent of linkage disequilibrium (LD), D′ and r2 between pairs of polymorphisms. Given the status of data distribution, independent samples t test, Mannwhitney U and one-way ANOVA or Kruskal-Wallis were also used. Odds ratios (OR) with 95% confidence intervals were calculated to determine the odds of developing PE when the individual has gene variants of interest. Comparison of genotype frequencies, association with the disease using the best inheritance model, LD statistics and haplotype analysis, including haplotype frequency estimation, as well as the analysis of association between haplotypes and PE were performed using SNP Stats software. P<0.05 was considered statistically significant.
The demographic and clinical characteristics of the studied subjects are presented in Table 2. The results of this study showed that there is a significant difference between the groups of patient (case) and control in terms of pregnancy weight gain and blood pressure; so that the weight in the patient group was significantly higher than the control group (P<0.001, OR=2.556).
According to this study, it was also found that there is
significant difference between systolic (P<0.001) and diastolic blood pressures (P<0.001) of these groups. So that
blood pressure in the patient group was higher than the
control group (
Polymerase chain reaction (PCR) amplification. Fragments of the gene were detected after electrophoresis on 1% agarose gel. Sizes of fragments are 520 bp and 256 bp.
We determined which allele combination from the two
SNPs associated with preeclampsia (
In addition, no significant difference was determined
in the frequency of rs922583280 and rs3025040 polymorphisms between the patient and control groups.
The frequency of recessive allele G, in the rs10434
polymorphism was significantly higher in the patient
group rather than that the control group (case=24, control=12 OR, R=2.316: from 1.167 to 4.594, P=0.014),
while the frequency of allele A in the control group
was higher than the patient group (case=76, control=88, OR=2.316: from 1.167 to 4.594, P=0.014).
The frequency of AG genotypes in the patient group
was also higher than control group (OR=2.452: from
1.099 to 5.467, P=0.026), while frequency of AA genotype in the control group was higher than the case
group (OR=2.675: from 1.229 to 5.820, P=0.012,
The interaction between any possible pair of SNPs
was visualized by SHEsis program. Analysis revealed
linkage disequilibrium (LD) between rs922583280
and rs3025040 (Dˊ=1.000 and r2=0.001), while
weak LD was determined between rs922583280 and
rs10434 as well as rs3025040 and rs10434 (Dˊ=0.062
and r2=0.001; Dˊ=0.299 and r2=0.001, respectively,
Minor allele frequency for VEGF SNPs were rs10434: A>G (A=0.3476/1741; 1000Genomes), rs3025040: C>T (T=0.1512/757; 1000Genomes), rs922583280 C>T (minor allele frequency is not specified.
Anthropometry and blood pressure data in the patient (case) and control groups
Characteristics | Case group | Control group | P value |
---|---|---|---|
Age (Y)a | 25.8 (7.16) | 24.7 (6.22) | 0.217 |
Gestational age (weeks)a | 32.9 (4.02) | 33.1 (4.71) | 0.797 |
Gestational weight gain (kg)b | 12.7 (8.50-16.50) | 10.0 (6.75-13.55) | 0.003* |
Systolic blood pressure (mmHg)b | 170 (160.0-180.0) | 110 (100.0-120.0) | <0.001* |
Diastolic blood pressure (mmHg)b | 110 (100.0-120.0) | 70 (70.0-80.0) | <0.001* |
Body mass index (kg/m2)b | 24.05 (21.63-28.13) | 23.35 (20.53-26.90) | 0.131 |
a; Characteristics are presented as mean (standard deviation), b; Characteristics are presented as median (ranges), and *; P<0.05: statistic significant.
Haplotype frequencies of VEGF rs922583280, rs3025040 and rs10434 polymorphisms in case and control groups
Haplotypes | Cases (%)n=100 | Controls (%)n=50 | P valuea | OR (95% CI) |
---|---|---|---|---|
C - C - A | 0.070 | 0.847 | 0.002 | 0.365 (0.187-0.712) |
C - C - G | 0.235 | 0.103 | 0.006 | 2.648 (1.283-5.467) |
C - T - A | 0.050 | 0.023 | 0.274 | 2.214 (0.514-9.543) |
Haplotype frequencies of VEGF rs922583280, rs3025040 and rs10434 polymorphisms in case and control groups
Gene | Case group (%) | Control group (%) | P valuea | OR (95% CI) |
---|---|---|---|---|
Rs922583280 | ||||
CC | 97.00 | 98.00 | 0.593 | 0.660 (0.067-6.507) |
CT | 3.00 | 2.00 | 0.593 | 0.660 (0.067-6.507) |
TT | 0.00 | 0.00 | ND | ND |
Frequency of C allele | 98.50 | 99.00 | 0.722 | 1.508 (0.155-14.681) |
Frequency of T allele | 1.50 | 1.00 | 0.722 | 1.508 (0.155-14.681) |
Rs3025040 | ||||
CC | 91.00 | 92.00 | 0.552 | 1.137 (0.332-3.891) |
CT | 8.00 | 8.00 | 1.00 | 1.00 (0.286-3.495) |
TT | 1.00 | 0.00 | 0.478 | 0.990 (0.971-1.010) |
Frequency of C allele | 95.00 | 96.00 | 0.102 | 0.474 (0.190-1.179) |
Frequency of T allele | 5.00 | 4.00 | 0.302 | 0.605 (0.231-1.585) |
Rs10434 | ||||
AA | 57.00 | 78.00 | 0.012* | 2.675 (1.229-5.820) |
AG | 38.00 | 20.00 | 0.026* | 2.452 (1.099-5.467) |
GG | 5.00 | 2.00 | 0.377 | 2.579 (0.29312.690) |
Frequency of A allele | 76.00 | 88.00 | 0.014* | 2.316 (1.167-4.594) |
Frequency of G allele | 24.00 | 12.00 | 0.014* | 2.316 (1.167-4.594) |
OR; Odds ratio, CI; Confidence interval, a; P<0.05: Statistically significant, and ND; Not defined
Minor allele frequency and Hardy-Weinberg tests for the study of population
SNP | MAF | HWE P |
---|---|---|
rs10434 | 0.3476 | 0.676 |
rs3025040 | 0.1512 | 0.114 |
rs922583280 | - | 0.878 |
SNP; Single nucleotide polymorphism, MAF; Minor allele frequency, and HWE P; HardyWeinberg equilibrium P value.
Untreated PE causes serious and fatal complications for
mother and baby (
In this study which was carried out on Iranian pregnant women with PE, a total number of 150 pregnant women, including 100 pregnant women diagnosed with PE and 50 healthy pregnant women, were examined. Mean age in the patients group was 25.8 ± 7.16 and in the control group was 24.7 ± 6.22. This difference was not significant. Analysis represented that frequency and distribution of rs10434 polymorphism allele and genotype in both control and case groups showed a significant difference, so that the frequency of recessive allele G in the patient group was significantly higher than the control group.
It was also found that frequency of the allele A in the
control group was higher than that of the patient group.
In the genotypic frequency study, the results showed that
frequency of AG genotype in the patient group was higher than the control group and frequency of AA genotype
in the control group was higher than that of the patient
group. In the case of rs922583280 and rs3025040, there
was no significant difference in the allele and genotype
frequency between these groups. The results of our data
were similar to the studies conducted on PE patients in
other populations, as it was found in the meta-analysis
study conducted on four VEGF gene polymorphisms by
Song et al. (
In general, it can be concluded that
Investigations showed that frequency and distribution of rs10434 polymorphism alleles and genotypes had significant difference between control and case groups, so that the frequency of recessive allele G in the patient group was significantly higher than the control group. In the genotypic frequency study, the results showed that frequency of AG genotype in the patient group was higher than the control. In the case of the frequency of alleles and genotypes for two polymorphisms rs922583280 and rs3025040, there was no significant difference between patient and control groups. Some of the limitations which can be mentioned here include small size population of the study and lack of the concomitant VEGF level in plasma. Further studies consisting of the larger and classified cohort are needed to validate our initial findings and to determine association of the other clinical variables and SNPs with the subtypes of PE. Moreover, several clinical parameters, including plasma VEGF, PlGF and sFlt-1 levels and polymorphisms of the other VEGF family (PlGF) members should be put into the prospective account.